Human LACE1 cDNA Clone BC018445 pENTR223.1 or pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL819895HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
LACE1
Gene ID:
246269
Accession #:
BC018445
Plasmid:
Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
€214.00
Frequently bought together:

Description

Human LACE1 cDNA Clone BC018445 pENTR223.1 or pUC Plasmid | Cusabio

Gene Name: LACE1

Gene ID: 246269

Accession Number: BC018445

Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC

Sequence: ATGGCGGCCTCCTGGTCGCTCTTGGTTACCCTGCGCCCCTTAGCACAGAGCCCGCTGAGAGGGAGATGTGTTGGGTGCGGGGCCTGGGCCGCCGCTCTCGCTCCTCTGGCCACCGCCCCTGGGAAGCCCTTTTGGAAAGCCTATACGGTTCAGACATCCGAGAGCATGACCCCAACTGCCACTTCAGAGACTTATTTGAAAGCTTTGGCCGTTTGCCATGGACCTCTGGACCACTATGATTTTCTGATCAAAGCTCATGAGCTAAAGGATGATGAACATCAAAGAAGAGTCATACAGTGTTTGCAGAAATTACACGAGGACCTTAAAGGATACAATATAGAGGCAGAAGGCCTTTTTTCAAAGCTTTTTTCAAGGAGCAAACCTCCAAGGGGCCTGTATGTTTATGGAGATGTTGGTACAGGAAAAACAATGGTGATGGACATGTTTTATGCTTATGTGGAAATGAAGAGGAAAAAACGGGTTCATTTTCATGGTTTCATGCTAGATGTGCACAAAAGAATACATCGCCTTAAACAGAGTTTGCCAAAAAGGAAACCAGGATTCATGGCTAAATCATATGACCCAATAGCTCCCATAGCCGAAGAAATCAGCGAAGAAGCATGTCTCCTATGTTTTGATGAATTTCAGGTCACTGACATTGCTGATGCCATGATTCTGAAACAGCTTTTTGAAAATCTGTTCAAAAACGGGGTCGTCGTTGTGGCAACATCCAACAGGCCACCGGAAGATCTCTATAAAAATGGACTCCAAAGAGCTAACTTTGTACCATTCATAGCAGTCTTGAAGGAATATTGTAATACAGTCCAGCTAGATTCTGGGATAGATTACCGGAAAAGGGAACTTCCTGCTGCAGGAAAACTCTACTACCTCACAAGTGAAGCTGATGTGGAGGCTGTCATGGATAAGTTGTTTGATGAGCTGGCTCAGAAACAAAATGATTTAACTAGACCAAGGATTCTAAAAGTGCAAGGCAGAGAGCTGCGCCTGAATAAAGCCTGTGGAACCGTTGCCGACTGCACATTTGAAGAGCTGTGTGAGAGACCACTTGGAGCCAGTGACTATTTGGAACTATCAAAGAATTTTGATACAATATTTTTACGAAACATTCCGCAATTTACTCTGGCAAACAGGACTCAAGGTCGAAGATTCATAACTCTCATCGATAACTTTTATGATCTCAAGGTGCGTATAATTTGCTCTGCGTCGACTCCTATATCAAGCTTATTTTTGCATCAACATCATGACAGTGAGTTGGAGCAAAGCAGAATACTGATGGATGATTTGGGGCTGAGCCAGGATTCAGCAGAAGGACTCTCCATGTTTACCGGAGAAGAGGAAATCTTTGCATTTCAGCGCACAATTTCCCGACTCACGGAAATGCAGACTGAACAGTACTGGAATGAAGGAGACAGAACCAAGAAGTAA

Length: 1446

View AllClose

0 Reviews

View AllClose