Human L3MBTL2 cDNA Clone BC017191 pENTR223.1 Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL839279HU
Availability:
3 to 5 Working Days
Size:
10 μg plasmid + 200μl Glycerol
Gene:
L3MBTL2
Gene ID:
83746
Accession #:
BC017191
Plasmid:
pENTR223.1
€214.00
Frequently bought together:

Description

Human L3MBTL2 cDNA Clone BC017191 pENTR223.1 Plasmid | Cusabio

Gene Name: L3MBTL2

Gene ID: 83746

Accession Number: BC017191

Vector: pENTR223.1

Sequence: ATGGAGAAGCCCCGGAGTATTGAGGAGACCCCATCTTCAGAACCAATGGAGGAAGAGGAAGATGACGACTTGGAGCTGTTTGGTGGCTATGATAGTTTCCGGAGTTATAACAGCAGTGTGGGCAGTGAGAGCAGCTCCTATCTGGAGGAGTCAAGTGAAGCAGAAAATGAGGATCGGGAAGCAGGGGAACTGCCGACCTCCCCGCTGCATTTGCTCAGCCCTGGGACTCCTCGCTCCTTGGATGGCAGTGGTTCTGAGCCAGCTGTCTGTGAGATGTGTGGTATCGTGGGTACAAGGGAAGCCTTCTTCTCCAAGACCAAGAGGTTCTGCAGCGTCTCCTGCTCCAGGAGCTACTCCTCCAACTCCAAGAAAGCCAGTATCTTGGCTAGATTACAGGGAAAACCACCGACCAAAAAAGCCAAAGTCCTGCACAAGGCTGCCTGGTCTGCCAAAATTGGAGCCTTCCTCCACTCTCAAGGGACAGGACAGCTGGCAGATGGGACACCAACAGGACAAGACGCTCTGGTCTTGGGCTTCGACTGGGGGAAGTTCCTGAAGGATCACAGTTACAAGGCTGCTCCCGTCAGCTGTTTCAAGCACGTCCCACTCTATGACCAGTGGGAGGATGTGATGAAAGGGATGAAGGTGGAGGTGCTCAACAGTGATGCTGTGCTCCCCAGCCGGGTGTACTGGATCGCCTCTGTCATCCAGACAGCAGGGTATCGGGTGCTGCTTCGGTATGAAGGCTTTGAAAATGACGCCAGCCATGACTTCTGGTGCAACCTGGGAACAGTGGATGTCCACCCCATTGGCTGGTGTGCCATCAACAGCAAGATCCTAGTGCCCCCACGGACCATCCATGCCAAGTTCACCGACTGGAAGGGCTACCTCATGAAACGGCTGGTGGGCTCCAGGACGCTTCCCGTGGATTTCCACATCAAGATGGTGGAGAGCATGAAGTACCCCTTTAGGCAGGGCATGCGGCTGGAAGTGGTGGACAAGTCCCAGGTGTCACGCACTCGCATGGCTGTGGTGGACACAGTAATCGGGGGTCGCCTACGGCTCCTCTACGAGGATGGTGACAGTGACGACGACTTCTGGTGCCACATGTGGAGCCCCCTGATCCACCCAGTGGGTTGGTCACGACGTGTGGGCCACGGCATCAAGATGTCAGAGAGGCGAAGTGACATGGCCCATCACCCCACCTTCCGGAAGATCTACTGTGATGCCGTTCCTTACCTCTTCAAGAAGGTACGAGCAGTCTACACAGAAGGCGGTTGGTTTGAGGAAGGGATGAAGCTGGAGGCCATTGACCCCCTGAATCTGGGCAACATCTGCGTGGCAACTGTCTGTAAGGTTCTCCTGGATGGATACCTGATGATCTGTGTGGACGGGGGGCCCTCCACAGATGGCTTGGACTGGTTCTGCTACCATGCCTCTTCCCACGCCATCTTCCCGGCCACCTTCTGTCAGAAGAATGACATTGAGCTCACACCGCCAAAAGGTTATGAGGCACAGACTTTCAACTGGGAGAACTACTTGGAGAAGACCAAGTCGAAAGCCGCTCCATCGAGACTCTTTAACATGGATTGCCCAAACCATGGCTTCAAGGTGGGCATGAAGCTGGAGGCCGTGGACCTGATGGAGCCCCGGCTCATCTGTGTGGCCACGGTGAAACGAGTGGTGCATCGGCTCCTCAGCATCCACTTTGACGGCTGGGACAGCGAGTACGACCAGTGGGTGGACTGCGAGTCCCCAGACATCTACCCCGTCGGCTGGTGTGAGCTCACCGGCTACCAGCTCCAGCCTCCTGTGGCCGCAGAACCGGCCACACCGCTGAAGGCCAAAGAGGCCACAAAGAAGAAAAAGAAACAGTTTGGGAAGAAAAGGAAAAGAATCCCGCCCACTAAGACGCGACCCCTCAGACAGGGGTCCAAGAAGCCCCTGCTGGAGGACGACCCTCAGGGTGCCAGGAAGATCTCGTCGGAGCCTGTTCCTGGCGAGATCATTGCTGTGCGTGTGAAGGAAGAGCATCTAGACGTGGCCTCGCCCGACAAGGCTTCAAGTCCAGAGCTGCCTGTCTCCGTCGAGAACATCAAGCAGGAAACAGACGACTGA

Length: 2118

View AllClose

0 Reviews

View AllClose