Human L2HGDH cDNA Clone BC006117 pENTR223.1 or pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL864008HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
L2HGDH
Gene ID:
79944
Accession #:
BC006117
Plasmid:
Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
€214.00
Frequently bought together:

Description

Human L2HGDH cDNA Clone BC006117 pENTR223.1 or pUC Plasmid | Cusabio

Gene Name: L2HGDH

Gene ID: 79944

Accession Number: BC006117

Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC

Sequence: ATGGTGCCAGCGCTGCGTTATTTGGTTGGTGCCTGCGGACGGGCCCGCGGGCGTTTCGCCGGTGGCTCCCCTGGGGCGTGCGGGTTCGCGTCTGGGAGGCCAAGACCGCTGTGTGGAGGTAGCCGCAGCGCCAGCACCAGCTCATTTGATATAGTCATTGTTGGTGGCGGAATTGTGGGGCTTGCCTCTGCCAGAGCACTCATCCTGCGACATCCATCACTTTCTATTGGTGTTCTGGAAAAGGAGAAAGATTTAGCTGTTCACCAGACTGGACATAACAGTGGTGTCATACATAGTGGAATTTATTATAAACCTGAGTCTCTGAAAGCCAAATTATGTGTACAAGGTGCAGCCCTCCTCTATGAGTACTGTCAGCAAAAGGGAATTTCCTACAAGCAGTGTGGCAAGCTTATAGTAGCTGTTGAACAAGAAGAAATTCCCAGACTTCAGGCCCTATATGAGAAAGGCCTCCAGAATGGTGTCCCGGGCCTGAGGCTGATCCAGCAGGAGGATATAAAAAAGAAGGAGCCATATTGTAGGGGTCTAATGGCTATTGATTGTCCACATACTGGCATTGTGGACTATCGGCAGGTGGCTTTGTCATTTGCCCAGGATTTCCAAGAAGCAGGTGGCTCTGTCTTGACCAATTTTGAAGTAAAAGGTATTGAAATGGCTAAAGAAAGTCCTTCAAGAAGTATAGATGGAATGCAATATCCAATTGTTATAAAGAATACAAAGGGAGAGGAAATTCGATGTCAGTATGTTGTGACATGTGCAGGACTTTACTCAGACCGTATTTCAGAGTTGAGTGGCTGCACTCCTGATCCTCGAATTGTACCATTCCGGGGAGATTACCTGCTTTTGAAGCCAGAAAAATGTTATCTTGTAAAAGGAAATATTTATCCGGTCCCAGATAGCCGGTTTCCTTTCCTAGGAGTTCACTTCACACCAAGGATGGATGGCAGTATTTGGCTAGGGCCTAATGCAGTTCTTGCCTTTAAACGAGAGGGTTACAGACCCTTTGACTTCAGTGCCACAGATGTTATGGATATAATTATCAATAGTGGCTTGATTAAACTGGCATCCCAGAATTTTTCCTATGGAGTTACTGAAATGTATAAAGCATGTTTTCTTGGTGCAACAGTGAAGTATCTTCAAAAATTCATCCCTGAAATTACTATCAGTGATATACTTAGGCAGGTGGCTGTGAGAGGACCGAGCTGGCTATGGCAGCAACCCATGAAAGTGAGTGATAACAACATTTATTGTTTCCTGTGGCGTTGCTTTGCTTTGCTATTGACTGGTAGCACTTGTAGCTTTAAATAA

Length: 1326

View AllClose

0 Reviews

View AllClose