Human L1TD1 cDNA Clone BC111559 pENTR223.1 or pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL729208HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
L1TD1
Gene ID:
54596
Accession #:
BC111559
Plasmid:
Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
€516.00
Frequently bought together:

Description

Human L1TD1 cDNA Clone BC111559 pENTR223.1 or pUC Plasmid | Cusabio

Gene Name: L1TD1

Gene ID: 54596

Accession Number: BC111559

Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC

Sequence: ATGTCTGATGTATCTACTAGTGTACAATCAAAATTTGCTAGACTTGCAAAGAAAAAGGAAAATATCACCTATATGAAAAGAGAGCAGTTAACAGAAACTGATAAGGACATAGCTCCGGTATTAGATTTAAAATGCAAGGACGTATCAGCAATTATGAATAAGTTTAAGGTCTTAATGGAAATTCAAGACCTGATGTTTGAGGAGATGAGGGAAACTCTTAAAAATGACCTAAAAGCAGTTTTAGGAGGAAAAGCTACAATACCTGAGGTAAAGAATTCAGAGAACTCCAGTAGTAGGACAGAGTTTCAGCAAATAATCAATTTAGCATTACAAAAAACAGGGATGGTAGGGAAAATAGAAGGAGAAAACTCTAAAATAGGTGATGATAATGAAAATTTAACCTTTAAATTAGAAGTAAATGAGCTGAGTGGTAAATTAGACAACACTAACGAATACAATAGTAATGATGGTAAGAAATTACCCCAGGGTGAATCACGAAGTTACGAAGTCATGGGAAGTATGGAAGAAACCTTATGCAATATAGATGACAGAGATGGAAATCGCAATGTCCATTTAGAATTTACAGAAAGAGAGAGTAGGAAGGATGGAGAGGATGAATTTGTCAAAGAAATGAGAGAGGAAAGAAAATTTCAGAAATTGAAGAATAAAGAGGAGGTTTTAAAAGCCTCCAGAGAAGAAAAAGTGTTGATGGATGAAGGAGCAGTACTTACCCTGGCAGCCGACCTTTCATCAGCAACACTGGATATTAGTAAGCAATGGAGTAATGTCTTCAACATTCTGAGAGAAAATGATTTTGAACCTAAATTTCTGTGTGAAGTTAAATTAGCATTTAAATGTGATGGTGAAATAAAGACATTTTCAGATCTGCAAAGCCTTAGAAAATTTGCCAGCCAAAAATCTTCTATGAAAGAATTACTGAAAGATGTACTCCCACAAAAGGAAGAAATAAATCAAGGAGGAAGAAACTATGGAATTCAAGAAAAAAGGGATAAAACCCTAATAGACTCAAAGCATAGAGCTGGAGAAATAACCAGTGATGGCTTGAGCTTCCTATTTCTTAAAGAAGTAAAAGTTGCTAAGCCAGAGGAGATGAAAAACTTAGAGACTCAAGAGGAAGAGTTTTCCGAGCTAGAGGAGCTGGATGAAGAGGCTTCAGGGATGGAGGATGATGAAGATACCTCAGGGCTGGAGGAGGAGGAGGAAGAGCCCTCAGGGCTGGAGGAGGAAGAAGAAGAAGAGGCTTCAGGGTTGGAGGAGGATGAGGCCTCAGGGCTAGAGGAGGAAGAGGAACAGACTTCAGAACAGGACTCAACCTTTCAGGGTCATACTTTGGTAGATGCAAAGCATGAAGTTGAGATAACCAGTGATGGCATGGAAACTACTTTCATTGACTCTGTAGAGGATTCTGAATCAGAGGAGGAAGAGGAAGGAAAGAGCTCTGAAACAGGAAAGGTAAAGACTACCTCCCTGACTGAGAAAAAAGCCTCACGTAGACAAAAAGAAATTCCCTTTAGTTATTTGGTTGGGGACTCTGGGAAGAAAAAGTTGGTGAAACACCAGGTGGTGCACAAAACCCAGGAGGAAGAGGAAACAGCTGTGCCCACAAGTCAAGGAACTGGCACACCCTGTCTGACCTTATGTTTGGCCTCTCCCTCAAAGTCACTAGAGATGAGTCATGATGAGCATAAAAAGCATTCACATACAAATTTGAGTATTTCAACAGGAGTCACCAAACTTAAGAAAACAGAAGAAAAGAAACACAGAACTCTGCACACAGAAGAACTAACATCCAAAGAAGCAGACTTAACAGAGGAAACAGAAGAAAACTTGAGAAGTAGTGTGATTAATAGCATCAGAGAGATAAAAGAGGAGATTGGAAATTTGAAAAGTTCCCATTCAGGTGTCTTGGAAATTGAAAATTCAGTAGATGATCTGAGTAGCAGAATGGACATACTTGAAGAAAGAATAGACAGTCTAGAAGATCAAATTGAAGAATTCTCTAAGGATACAATGCAAATGACCAAACAGATAATTAGTAAAGAAAGGCAAAGAGATATAGAGGAGAGATCTAGAAGTTGCAACATTCGTTTGATAGGAATTCCAGAAAAGGAGAGTTATGAGAATAGGGCAGAGGACATAATTAAGGAAATAATTGATGAAAACTTTGCAGAACTAAAGAAAGGTTCAAGTCTTGAGATTGTCAGTGCTTGTCGAGTACCTAGTAAAATTGATGAAAAGAGACTGACTCCTAGACACATCTTGGTGAAATTTTGGAATTCTAGTGATAAAGAGAAAATAATAAGGGCTTCTAGAGAGAGAAGAGAAATTACCTACCAAGGAACAAGAATCAGGTTGACAGCAGACTTATCACTGGACACACTGGATGCTAGAAGTAAATGGAGCAATGTCTTCAAAGTTCTGCTGGAAAAAGGCTTTAATCCTAGAATCCTATATCCAGCCAAAATGGCATTTGATTTTAGGGGTAAAACAAAGGTATTTCTTAGTATTGAAGAATTTAGAGATTATGTTTTGCATATGCCCACCTTGAGAGAATTACTGGGGAATAATATACCTTAG

Length: 2598

View AllClose

0 Reviews

View AllClose