Cusabio Customized Plasmid
Human KRTAP4-2 cDNA Clone BC127252 pENTR223.1 or pUC Plasmid
(No reviews yet)
Write a Review
- SKU:
- CSB-CL861178HU
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- KRTAP4-2
- Gene ID:
- 85291
- Accession #:
- BC127252
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
Description
Human KRTAP4-2 cDNA Clone BC127252 pENTR223.1 or pUC Plasmid | Cusabio
Gene Name: KRTAP4-2
Gene ID: 85291
Accession Number: BC127252
Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
Sequence: ATGGTCAACTCCTGTTGTGGCTCTGTGTGCTCTGACCAGGGCTGTGGCCTAGAGAACTGCTGCCGTCCCAGCTGCTGCCAGACCACCTGCTGCAGGACCACCTGCTGCCGCCCCAGCTGCTGTGTGTCCAGCTGCTGCAGACCGCAGTGCTGCCAGTCTGTGTGCTGCCAGCCCACCTGCTGCAGCCCCAGCTGCTGCCAGACCACTTGCTGCAGGACCACCTGCTGCCGTCCCAGCTGCTGTGTGTCCAGCTGCTTCAGACCCCAGTGCTGCCAGTCTGTGTGCTGCCAGCCCACCTGCTGCCGCCCCAGCTGTGGCCAGACCACCTGCTGCAGGACCACCTGCTACCGCCCCAGCTGCTGTGTGTCCACCTGCTGCCGCCCAACCTGCTCTAGTGGCTCTTGCTGCTGA
Length: 411
Related Products
Human KRTAP4-1 cDNA Clone BC103846 pENTR223.1 or pUC Plasmid
Cusabio Customized Plasmid
£171.20
Human KRTAP4-1 cDNA Clone BC103846 pENTR223.1 or pUC Plasmid | CusabioGene Name: KRTAP4-1Gene ID: 85285Accession Number: BC103846Vector: Vector will be determined during the manufacturing process,...
- SKU:
- CSB-CL874845HU
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- KRTAP4-1
- Gene ID:
- 85285
- Accession #:
- BC103846
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
Human KRTAP4-7 cDNA Clone BC126421 pUC Plasmid
Cusabio pUC Plasmid
£212.00
Human KRTAP4-7 cDNA Clone BC126421 pUC Plasmid | CusabioGene Name: KRTAP4-7Gene ID: 85287Accession Number: BC126421Vector: pUCSequence:...
- SKU:
- CSB-CL863159HU
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- KRTAP4-7
- Gene ID:
- 85287
- Accession #:
- BC126421
- Plasmid:
- pUC
Human KRTAP4-12 cDNA Clone BC004180 pUC Plasmid
Cusabio pUC Plasmid
£205.60
Human KRTAP4-12 cDNA Clone BC004180 pUC Plasmid | CusabioGene Name: KRTAP4-12Gene ID: 83755Accession Number: BC004180Vector: pUCSequence:...
- SKU:
- CSB-CL859029HU
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- KRTAP4-12
- Gene ID:
- 83755
- Accession #:
- BC004180
- Plasmid:
- pUC
Human KRTAP4-11 cDNA Clone BC126131 pUC Plasmid
Cusabio pUC Plasmid
£202.40
Human KRTAP4-11 cDNA Clone BC126131 pUC Plasmid | CusabioGene Name: KRTAP4-11Gene ID: 85282Accession Number: BC126131Vector: pUCSequence:...
- SKU:
- CSB-CL861177HU
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- KRTAP4-11
- Gene ID:
- 85282
- Accession #:
- BC126131
- Plasmid:
- pUC
Human KRTAP12-2 cDNA Clone BC120941 pENTR223.1 or pUC Plasmid
Cusabio Customized Plasmid
£171.20
Human KRTAP12-2 cDNA Clone BC120941 pENTR223.1 or pUC Plasmid | CusabioGene Name: KRTAP12-2Gene ID: 353323Accession Number: BC120941Vector: Vector will be determined during the manufacturing process,...
- SKU:
- CSB-CL012606HU
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- KRTAP12-2
- Gene ID:
- 353323
- Accession #:
- BC120941
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
Human KRTAP3-2 cDNA Clone BC034582 pENTR223.1 or pUC Plasmid
Cusabio Customized Plasmid
£171.20
Human KRTAP3-2 cDNA Clone BC034582 pENTR223.1 or pUC Plasmid | CusabioGene Name: KRTAP3-2Gene ID: 83897Accession Number: BC034582Vector: Vector will be determined during the manufacturing process,...
- SKU:
- CSB-CL871617HU
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- KRTAP3-2
- Gene ID:
- 83897
- Accession #:
- BC034582
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
Human TMEM206 cDNA Clone BC006320 pENTR223.1 or pUC Plasmid
Cusabio Customized Plasmid
£171.20
Human TMEM206 cDNA Clone BC006320 pENTR223.1 or pUC Plasmid | CusabioGene Name: TMEM206Gene ID: 55248Accession Number: BC006320Vector: Vector will be determined during the manufacturing process,...
- SKU:
- CSB-CL023800HU
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- TMEM206
- Gene ID:
- 55248
- Accession #:
- BC006320
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
Human TLR10 cDNA Clone BC109112 pENTR223.1 or pUC Plasmid
Cusabio Customized Plasmid
£350.40
Human TLR10 cDNA Clone BC109112 pENTR223.1 or pUC Plasmid | CusabioGene Name: TLR10Gene ID: 81793Accession Number: BC109112Vector: Vector will be determined during the manufacturing process, either...
- SKU:
- CSB-CL023600HU
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- TLR10
- Gene ID:
- 81793
- Accession #:
- BC109112
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
Human TMCO3 cDNA Clone BC012564 pENTR223.1 or pUC Plasmid
Cusabio Customized Plasmid
£171.20
Human TMCO3 cDNA Clone BC012564 pENTR223.1 or pUC Plasmid | CusabioGene Name: TMCO3Gene ID: 55002Accession Number: BC012564Vector: Vector will be determined during the manufacturing process, either...
- SKU:
- CSB-CL754406HU1
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- TMCO3
- Gene ID:
- 55002
- Accession #:
- BC012564
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC