Cusabio Customized Plasmid
Human KRTAP4-1 cDNA Clone BC103846 pENTR223.1 or pUC Plasmid
(No reviews yet)
Write a Review
- SKU:
- CSB-CL874845HU
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- KRTAP4-1
- Gene ID:
- 85285
- Accession #:
- BC103846
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
Description
Human KRTAP4-1 cDNA Clone BC103846 pENTR223.1 or pUC Plasmid | Cusabio
Gene Name: KRTAP4-1
Gene ID: 85285
Accession Number: BC103846
Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
Sequence: ATGGTTAACTCTTGTTGTGGCTCTGTCTGCTCTGACCAGGGCTGTGATCAAGGCCTCTGCCAAGAGACCTGCTGCCGCCCCAGCTGCTGCCAGACCACCTGTTGCTGCCCCAGCTGTGTTGTATCCAGCTGCTGCCGCCCATCCTGCTCTCAGACTACCTGCTGCCAGACCACTTGCTGTCGCCCCAGCTGCTGCCGCCCAGTCTGTTGTCAGACCACCTGCCGCCCCAGCTGTGGTGTGTCCAGCTGCTGCCGTCCACTCTGTTGTCAGACCACCTGCCGCCCCAGCTGTGGTGTGTCCAGCTGCTGCCGTCCACTCTGCTGTCAGACCACCTGCTGCCGTACAACTTGCTGCCGCCCCAGCTGCTGTGGATCCTCTTGTTGA
Length: 384
Related Products
Human KRTAP4-2 cDNA Clone BC127252 pENTR223.1 or pUC Plasmid
Cusabio Customized Plasmid
€214.00
Human KRTAP4-2 cDNA Clone BC127252 pENTR223.1 or pUC Plasmid | CusabioGene Name: KRTAP4-2Gene ID: 85291Accession Number: BC127252Vector: Vector will be determined during the manufacturing process,...
- SKU:
- CSB-CL861178HU
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- KRTAP4-2
- Gene ID:
- 85291
- Accession #:
- BC127252
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
Human KRTAP4-7 cDNA Clone BC126421 pUC Plasmid
Cusabio pUC Plasmid
€265.00
Human KRTAP4-7 cDNA Clone BC126421 pUC Plasmid | CusabioGene Name: KRTAP4-7Gene ID: 85287Accession Number: BC126421Vector: pUCSequence:...
- SKU:
- CSB-CL863159HU
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- KRTAP4-7
- Gene ID:
- 85287
- Accession #:
- BC126421
- Plasmid:
- pUC
Human KRTAP4-12 cDNA Clone BC004180 pUC Plasmid
Cusabio pUC Plasmid
€257.00
Human KRTAP4-12 cDNA Clone BC004180 pUC Plasmid | CusabioGene Name: KRTAP4-12Gene ID: 83755Accession Number: BC004180Vector: pUCSequence:...
- SKU:
- CSB-CL859029HU
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- KRTAP4-12
- Gene ID:
- 83755
- Accession #:
- BC004180
- Plasmid:
- pUC
Human KRTAP4-11 cDNA Clone BC126131 pUC Plasmid
Cusabio pUC Plasmid
€253.00
Human KRTAP4-11 cDNA Clone BC126131 pUC Plasmid | CusabioGene Name: KRTAP4-11Gene ID: 85282Accession Number: BC126131Vector: pUCSequence:...
- SKU:
- CSB-CL861177HU
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- KRTAP4-11
- Gene ID:
- 85282
- Accession #:
- BC126131
- Plasmid:
- pUC
Human KRTAP11-1 cDNA Clone BC130555 pENTR223.1 or pUC Plasmid
Cusabio Customized Plasmid
€214.00
Human KRTAP11-1 cDNA Clone BC130555 pENTR223.1 or pUC Plasmid | CusabioGene Name: KRTAP11-1Gene ID: 337880Accession Number: BC130555Vector: Vector will be determined during the manufacturing process,...
- SKU:
- CSB-CL810266HU
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- KRTAP11-1
- Gene ID:
- 337880
- Accession #:
- BC130555
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
Human KRTAP8-1 cDNA Clone BC130397 pENTR223.1 or pUC Plasmid
Cusabio Customized Plasmid
€214.00
Human KRTAP8-1 cDNA Clone BC130397 pENTR223.1 or pUC Plasmid | CusabioGene Name: KRTAP8-1Gene ID: 337879Accession Number: BC130397Vector: Vector will be determined during the manufacturing process,...
- SKU:
- CSB-CL814201HU
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- KRTAP8-1
- Gene ID:
- 337879
- Accession #:
- BC130397
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
Human KRTAP19-1 cDNA Clone BC126284 pENTR223.1 or pUC Plasmid
Cusabio Customized Plasmid
€214.00
Human KRTAP19-1 cDNA Clone BC126284 pENTR223.1 or pUC Plasmid | CusabioGene Name: KRTAP19-1Gene ID: 337882Accession Number: BC126284Vector: Vector will be determined during the manufacturing process,...
- SKU:
- CSB-CL814200HU
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- KRTAP19-1
- Gene ID:
- 337882
- Accession #:
- BC126284
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
Human KRTAP13-1 cDNA Clone BC113536 pENTR223.1 or pUC Plasmid
Cusabio Customized Plasmid
€214.00
Human KRTAP13-1 cDNA Clone BC113536 pENTR223.1 or pUC Plasmid | CusabioGene Name: KRTAP13-1Gene ID: 140258Accession Number: BC113536Vector: Vector will be determined during the manufacturing process,...
- SKU:
- CSB-CL815543HU
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- KRTAP13-1
- Gene ID:
- 140258
- Accession #:
- BC113536
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
Human KRTAP26-1 cDNA Clone BC057825 pENTR223.1 or pUC Plasmid
Cusabio Customized Plasmid
€214.00
Human KRTAP26-1 cDNA Clone BC057825 pENTR223.1 or pUC Plasmid | CusabioGene Name: KRTAP26-1Gene ID: 388818Accession Number: BC057825Vector: Vector will be determined during the manufacturing process,...
- SKU:
- CSB-CL764791HU
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- KRTAP26-1
- Gene ID:
- 388818
- Accession #:
- BC057825
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC