Cusabio Customized Plasmid
Human KRTAP2-4 cDNA Clone BC101147 pENTR223.1 or pUC Plasmid
- SKU:
- CSB-CL887166HU
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- KRTAP2-4
- Gene ID:
- 85294
- Accession #:
- BC101147
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
Description
Human KRTAP2-4 cDNA Clone BC101147 pENTR223.1 or pUC Plasmid | Cusabio
Gene Name: KRTAP2-4
Gene ID: 85294
Accession Number: BC101147
Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
Sequence: ATGACCGGCTCCTGCTGCGGCTCCACCTTGTCCTCCCTGAGCTACGGGGGAGGCTGCTGCCAGCCCTGCTGCTGCCGCGACCCCTGCTGCTGCCGCCCCGTGACCTGCCAGACCACCGTGTGCCGCCCCGTGACCTGCGTGCCCCGCTGCACGCGCCCCATCTGCGAGCCCTGCCGCCGCCCGGTGTGCTGCGACCCCTGCTCCCTGCAGGAAGGCTGCTGCCGCCCCATCACCTGCTGCCCCTCGTCGTGCACGGCTGTGGTGTGCAGGCCCTGCTGCTGGGCCACCACCTGCTGCCAGCCTGTGTCTGTGCAGTCCCCCTGCTGCCGGCCCCCCTGCGGCCAGCCGACCCCTTGCAGCACCACCTGCAGGACCTCCTCCTGCTGA
Length: 387
Related Products
Human KRTAP12-4 cDNA Clone BC125198 pENTR223.1 or pUC Plasmid
Cusabio Customized Plasmid
- SKU:
- CSB-CL012608HU
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- KRTAP12-4
- Gene ID:
- 386684
- Accession #:
- BC125198
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
Human KRTAP19-4 cDNA Clone BC117199 pENTR223.1 or pUC Plasmid
Cusabio Customized Plasmid
- SKU:
- CSB-CL660772HU2
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- KRTAP19-4
- Gene ID:
- 337971
- Accession #:
- BC117199
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
Human KRTAP13-4 cDNA Clone BC131691 pENTR223.1 or pUC Plasmid
Cusabio Customized Plasmid
- SKU:
- CSB-CL667309HU
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- KRTAP13-4
- Gene ID:
- 284827
- Accession #:
- BC131691
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
Human KRTAP19-4 cDNA Clone BC117197 pENTR223.1 or pUC Plasmid
Cusabio Customized Plasmid
- SKU:
- CSB-CL660772HU1
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- KRTAP19-4
- Gene ID:
- 337971
- Accession #:
- BC117197
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
Human TMEM206 cDNA Clone BC006320 pENTR223.1 or pUC Plasmid
Cusabio Customized Plasmid
- SKU:
- CSB-CL023800HU
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- TMEM206
- Gene ID:
- 55248
- Accession #:
- BC006320
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC