Cusabio Customized Plasmid
Human KRTAP19-1 cDNA Clone BC126284 pENTR223.1 or pUC Plasmid
(No reviews yet)
Write a Review
- SKU:
- CSB-CL814200HU
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- KRTAP19-1
- Gene ID:
- 337882
- Accession #:
- BC126284
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
Description
Human KRTAP19-1 cDNA Clone BC126284 pENTR223.1 or pUC Plasmid | Cusabio
Gene Name: KRTAP19-1
Gene ID: 337882
Accession Number: BC126284
Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
Sequence: ATGAGTCACTACGGCAGCTACTACGGAGGCCTGGGCTACAGCTGTGGAGGCTTCGGTGGCCTGGGCTATGGCTATGGCTGTGGATGTGGCAGCTTCTGCAGACGGGGTTCTGGCTGTGGCTATGGAGGCTACGGATATGGCTCTGGCTTTGGAAGCTACGGATATGGCTCTGGCTTTGGAGGCTACGGATATGGCTCTGGCTTTGGAGGCTATGGATATGGCTGCTGCCGCCCATCGTACAATGGAGGATACGGATTCTCTGGCTTTTATTAA
Length: 273
Related Products
Human KRTAP19-4 cDNA Clone BC117197 pENTR223.1 or pUC Plasmid
Cusabio Customized Plasmid
£171.20
Human KRTAP19-4 cDNA Clone BC117197 pENTR223.1 or pUC Plasmid | CusabioGene Name: KRTAP19-4Gene ID: 337971Accession Number: BC117197Vector: Vector will be determined during the manufacturing process,...
- SKU:
- CSB-CL660772HU1
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- KRTAP19-4
- Gene ID:
- 337971
- Accession #:
- BC117197
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
Human KRTAP19-4 cDNA Clone BC117199 pENTR223.1 or pUC Plasmid
Cusabio Customized Plasmid
£171.20
Human KRTAP19-4 cDNA Clone BC117199 pENTR223.1 or pUC Plasmid | CusabioGene Name: KRTAP19-4Gene ID: 337971Accession Number: BC117199Vector: Vector will be determined during the manufacturing process,...
- SKU:
- CSB-CL660772HU2
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- KRTAP19-4
- Gene ID:
- 337971
- Accession #:
- BC117199
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
Human KRTAP19-5 cDNA Clone BC100836 pENTR223.1 or pUC Plasmid
Cusabio Customized Plasmid
£171.20
Human KRTAP19-5 cDNA Clone BC100836 pENTR223.1 or pUC Plasmid | CusabioGene Name: KRTAP19-5Gene ID: 337972Accession Number: BC100836Vector: Vector will be determined during the manufacturing process,...
- SKU:
- CSB-CL659465HU
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- KRTAP19-5
- Gene ID:
- 337972
- Accession #:
- BC100836
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
Human KRTAP19-7 cDNA Clone BC103838 pENTR223.1 or pUC Plasmid
Cusabio Customized Plasmid
£171.20
Human KRTAP19-7 cDNA Clone BC103838 pENTR223.1 or pUC Plasmid | CusabioGene Name: KRTAP19-7Gene ID: 337974Accession Number: BC103838Vector: Vector will be determined during the manufacturing process,...
- SKU:
- CSB-CL668785HU
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- KRTAP19-7
- Gene ID:
- 337974
- Accession #:
- BC103838
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
Human KRTAP8-1 cDNA Clone BC130397 pENTR223.1 or pUC Plasmid
Cusabio Customized Plasmid
£171.20
Human KRTAP8-1 cDNA Clone BC130397 pENTR223.1 or pUC Plasmid | CusabioGene Name: KRTAP8-1Gene ID: 337879Accession Number: BC130397Vector: Vector will be determined during the manufacturing process,...
- SKU:
- CSB-CL814201HU
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- KRTAP8-1
- Gene ID:
- 337879
- Accession #:
- BC130397
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC