Cusabio Customized Plasmid
Human KRTAP12-1 cDNA Clone BC127648 pENTR223.1 or pUC Plasmid
(No reviews yet)
Write a Review
- SKU:
- CSB-CL012605HU
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- KRTAP12-1
- Gene ID:
- 353332
- Accession #:
- BC127648
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
Description
Human KRTAP12-1 cDNA Clone BC127648 pENTR223.1 or pUC Plasmid | Cusabio
Gene Name: KRTAP12-1
Gene ID: 353332
Accession Number: BC127648
Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
Sequence: ATGTGCCACACCAGCTGCTCCTCGGGCTGCCAGCCAGCCTGCTGCGCGCCCAGCCCCTGCCAGGCATCCTGTTACATCCCCGTGGGCTGCCAGTCCTCCGTGTGCGTGCCCGTGAGCTTCAAGCCAGCCGTGTGTGTGCCCGTGAGATGCCAGTCCTCTGTGTGCGTGCCCGTGAGCTGCAGGCCCGTCGTGTATGCGGCTCCCTCCTGCCAGTCCTCTGGGTGCTGCCAGCCTTCCTGCACCAGCGTCCTCTGCAGACCCATCTCCTGCAGCACCCCTTCCTGCTGCTGA
Length: 291
Related Products
Human KRTAP12-2 cDNA Clone BC120941 pENTR223.1 or pUC Plasmid
Cusabio Customized Plasmid
£171.20
Human KRTAP12-2 cDNA Clone BC120941 pENTR223.1 or pUC Plasmid | CusabioGene Name: KRTAP12-2Gene ID: 353323Accession Number: BC120941Vector: Vector will be determined during the manufacturing process,...
- SKU:
- CSB-CL012606HU
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- KRTAP12-2
- Gene ID:
- 353323
- Accession #:
- BC120941
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
Human KRTAP12-4 cDNA Clone BC125198 pENTR223.1 or pUC Plasmid
Cusabio Customized Plasmid
£171.20
Human KRTAP12-4 cDNA Clone BC125198 pENTR223.1 or pUC Plasmid | CusabioGene Name: KRTAP12-4Gene ID: 386684Accession Number: BC125198Vector: Vector will be determined during the manufacturing process,...
- SKU:
- CSB-CL012608HU
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- KRTAP12-4
- Gene ID:
- 386684
- Accession #:
- BC125198
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
Human KRTAP8-1 cDNA Clone BC130397 pENTR223.1 or pUC Plasmid
Cusabio Customized Plasmid
£171.20
Human KRTAP8-1 cDNA Clone BC130397 pENTR223.1 or pUC Plasmid | CusabioGene Name: KRTAP8-1Gene ID: 337879Accession Number: BC130397Vector: Vector will be determined during the manufacturing process,...
- SKU:
- CSB-CL814201HU
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- KRTAP8-1
- Gene ID:
- 337879
- Accession #:
- BC130397
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
Human KRTAP19-1 cDNA Clone BC126284 pENTR223.1 or pUC Plasmid
Cusabio Customized Plasmid
£171.20
Human KRTAP19-1 cDNA Clone BC126284 pENTR223.1 or pUC Plasmid | CusabioGene Name: KRTAP19-1Gene ID: 337882Accession Number: BC126284Vector: Vector will be determined during the manufacturing process,...
- SKU:
- CSB-CL814200HU
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- KRTAP19-1
- Gene ID:
- 337882
- Accession #:
- BC126284
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
Human KRTAP13-1 cDNA Clone BC113536 pENTR223.1 or pUC Plasmid
Cusabio Customized Plasmid
£171.20
Human KRTAP13-1 cDNA Clone BC113536 pENTR223.1 or pUC Plasmid | CusabioGene Name: KRTAP13-1Gene ID: 140258Accession Number: BC113536Vector: Vector will be determined during the manufacturing process,...
- SKU:
- CSB-CL815543HU
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- KRTAP13-1
- Gene ID:
- 140258
- Accession #:
- BC113536
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC