null

Human KCND1 cDNA Clone BC045659 pENTR223.1 or pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL865130HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
KCND1
Gene ID:
3750
Accession #:
BC045659
Plasmid:
Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
€347.00
Frequently bought together:

Description

Human KCND1 cDNA Clone BC045659 pENTR223.1 or pUC Plasmid | Cusabio

Gene Name: KCND1

Gene ID: 3750

Accession Number: BC045659

Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC

Sequence: ATGGCGGCAGGCCTGGCCACGTGGCTGCCTTTTGCTCGGGCAGCAGCAGTGGGCTGGCTGCCCCTGGCCCAGCAACCCCTGCCCCCGGCACCGGGGGTGAAGGCATCTCGAGGAGATGAGGTTCTGGTGGTGAACGTGAGCGGACGGCGCTTTGAGACTTGGAAGAATACGCTGGACCGCTACCCAGACACCTTGCTGGGCAGCTCGGAGAAGGAATTCTTCTACGATGCTGACTCAGGCGAGTACTTCTTCGATCGCGACCCTGACATGTTCCGCCATGTGCTGAACTTCTACCGAACGGGGCGGCTGCATTGCCCACGGCAGGAGTGCATCCAGGCCTTCGACGAAGAGCTGGCTTTCTACGGCCTGGTTCCCGAGCTAGTCGGTGACTGCTGCCTTGAAGAGTATCGGGACCGAAAGAAGGAGAATGCCGAGCGCCTGGCAGAGGATGAGGAGGCAGAGCAGGCCGGGGACGGCCCAGCCCTGCCAGCAGGCAGCTCCCTGCGGCAGCGGCTCTGGCGGGCCTTCGAGAATCCACACACGAGCACCGCAGCCCTCGTTTTCTACTATGTGACCGGCTTCTTCATCGCCGTGTCGGTCATCGCCAATGTGGTGGAGACCATCCCATGCCGCGGCTCTGCACGCAGGTCCTCAAGGGAGCAGCCCTGTGGCGAACGCTTCCCACAGGCCTTTTTCTGCATGGACACAGCCTGTGTACTCATATTCACAGGTGAATACCTCCTGCGGCTGTTTGCCGCCCCCAGCCGTTGCCGCTTCCTGCGGAGTGTCATGAGCCTCATCGACGTGGTGGCCATCCTGCCCTACTACATTGGGCTTTTGGTGCCCAAGAACGACGATGTCTCTGGCGCCTTTGTCACCCTGCGTGTGTTCCGGGTGTTTCGCATCTTCAAGTTCTCCAGGCACTCACAGGGCTTGAGGATTCTGGGCTACACACTCAAGAGCTGTGCCTCTGAGCTGGGCTTTCTCCTCTTTTCCCTAACCATGGCCATCATCATCTTTGCCACTGTCATGTTTTATGCTGAGAAGGGCACAAACAAGACCAACTTTACAAGCATCCCTGCGGCCTTCTGGTATACCATTGTCACCATGACCACGCTTGGCTACGGAGACATGGTGCCCAGCACCATTGCTGGCAAGATTTTCGGGTCCATCTGCTCACTCAGTGGCGTCTTGGTCATTGCCCTGCCTGTGCCAGTCATTGTGTCCAACTTTAGCCGCATCTACCACCAGAACCAGCGGGCTGACAAGCGCCGAGCACAGCAGAAGGTGCGCTTGGCAAGGATCCGATTGGCAAAGAGTGGTACCACCAATGCCTTCCTGCAGTACAAGCAGAATGGGGGCCTTGAGGACAGCGGCAGTGGCGAGGAACAGGCTCTTTGTGTCAGGAACCGTTCTGCCTTTGAACAGCAACATCACCACTTGCTGCACTGTCTAGAGAAGACAACGTGCCATGAGTTCACAGATGAGCTCACCTTCAGTGAAGCCCTGGGAGCCGTCTCGCCGGGTGGCCGCACCAGCCGTAGCACCTCTGTGTCTTCCCAGCCAGTGGGACCCGGAAGCCTGCTGTCTTCTTGCTGCCCTCGCAGGGCCAAGCGCCGCGCCATCCGCCTTGCCAACTCCACTGCCTCAGTCAGCCGTGGCAGCATGCAGGAGCTGGACATGCTGGCAGGGCTGCGCAGGAGCCATGCCCCTCAGAGCCGCTCCAGCCTCAATGCCAAGCCCCATGACAGCCTTGACCTGAACTGCGACAGCCGGGACTTCGTGGCTGCCATTATCAGCATCCCTACCCCTCCTGCCAACACCCCAGATGAGAGCCAACCTTCCTCCCCTGGCGGCGGTGGCAGGGCCGGCAGCACCCTCAGGAACTCCAGCCTGGGTACCCCTTGCCTCTTCCCCGAGACTGTCAAGATCTCATCCCTGTGA

Length: 1944

View AllClose

0 Reviews

View AllClose