null

Human JARID2 cDNA Clone BC046246 pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL852915HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
JARID2
Gene ID:
3720
Accession #:
BC046246
Plasmid:
pUC
€1,221.00
Frequently bought together:

Description

Human JARID2 cDNA Clone BC046246 pUC Plasmid | Cusabio

Gene Name: JARID2

Gene ID: 3720

Accession Number: BC046246

Vector: pUC

Sequence: ATGAGCAAGGAAAGACCCAAGAGGAATATCATTCAGAAGAAATACGATGACAGTGATGGGATTCCGTGGTCAGAAGAACGGGTGGTACGTAAAGTCCTTTATTTGTCTCTGAAGGAGTTCAAGAATTCCCAGAAGAGGCAGCATGCGGAAGGCATTGCTGGGAGCCTGAAAACTGTGAATGGGCTCCTTGGTAATGACCAGTCTAAGGGATTAGGACCAGCATCAGAACAGTCAGAGAATGAAAAGGACGATGCATCCCAAGTGTCCTCCACTAGCAACGATGTTAGTTCTTCAGATTTTGAAGAAGGGCCGTCGAGGAAAAGGCCCAGGCTGCAAGCACAAAGGAAGTTTGCTCAGTCTCAGCCGAATAGTCCCAGCACAACTCCAGTAAAGATAGTGGAGCCATTGCTACCCCCTCCAGCTACTCAGATATCAGACCTCTCTAAAAGGAAGCCTAAGACAGAAGATTTTCTTACCTTTCTCTGCCTTCGAGGTTCTCCTGCGCTGCCCAACAGCATGGTGTATTTTGGAAGCTCTCAGGATGAGGAGGAAGTCGAGGAGGAAGATGATGAGACAGAAGACGTCAAAACAGCCACCAACAATGCTTCATCTTCATGCCAGTCGACCCCCAGGAAAGGAAAAACCCACAAACATGTTCACAACGGGCATGTTTTCAATGGTTCCAGCAGGTCAACACGGGAGAAGGAACCTGTTCAAAAACACAAAAGCAAAGAGGCCACTCCCGCAAAGGAGAAGCACAGCGATCACCGGGCTGACAGCCGCCGGGAGCAGGCTTCAGCTAACCACCCCGCAGCGGCCCCCTCCACGGGTTCCTCGGCCAAGGGGCTTGCTGCCACCCATCACCACCCCCCTCTGCATCGGTCGGCTCAGGACTTACGGAAACAGGTTTCTAAGGTAAACGGAGTCACTCGAATGTCATCTCTGGGTGCAGGTGTAACCAGTGCCAAAAAGATGCGCGAGGTCAGACCTTCACCATCCAAAACTGTGAAGTACACTGCCACGGTGACGAAGGGGGCTGTCACATACACCAAAGCCAAGAGAGAACTGGTCAAGGACACCAAACCCAATCACCACAAGCCCAGTTCCGCTGTCAACCACACAATCTCAGGGAAAACTGAAAGTAGCAATGCAAAAACCCGCAAACAGGTGCTATCCCTCGGGGGGGCGTCCAAGTCCACTGGGCCCGCCGTCAATGGCCTCAAGGTCAGTGGCAGGTTGAACCCAAAGTCATGCACTAAGGAGGTGGGGGGGCGGCAGCTGCGGGAGGGCCTGCAGCTGCGGGAGGGGCTGCGGAACTCCAAGAGGAGACTGGAAGAGGCACACCAGGCGGAGAAGCCGCAGTCGCCCCCCAAGAAGATGAAAGGGGCGGCTGGCCCCGCCGAAGGCCCTGGCAAGAAGGCCCCGGCCGAGAGAGGTCTGCTGAACGGACACGTGAAGAAGGAAGTGCCGGAGCGCAGTCTGGAGAGGAATCGGCCGAAGCGGGCCACGGCCGGGAAGAGCACGCCAGGCAGACAAGCACATGGCAAGGCGGACAGCGCCTCCTGTGAAAATCGTTCTACCTCGCAACCGGAGTCCGTGCACAAGCCGCAGGACTCGGGCAAGGCCGAGAAGGGCGGCGGCAAGGCCGGGTGGGCGGCCATGGACGAGATCCCCGTCCTCAGGCCCTCCGCCAAGGAGTTCCACGATCCGCTCATCTACATCGAGTCGGTCCGCGCTCAGGTGGAGAAGTTCGGGATGTGCAGGGTGATCCCCCCTCCGGACTGGCGGCCCGAGTGCAAGCTCAACGATGAGATGCGGTTTGTCACGCAGATTCAGCACATCCACAAGCTGGGCCGGCGCTGGGGCCCCAACGTGCAGCGGCTGGCCTGCATCAAGAAGCACCTCAAATCTCAGGGCATCACCATGGACGAGCTCCCGCTCATAGGGGGCTGTGAGCTCGACCTGGCCTGCTTTTTCCGGCTGATTAATGAGATGGGCGGCATGCAGCAAGTGACTGACCTCAAAAAATGGAACAAACTAGCAGACATGCTGCGCATCCCCAGAACTGCCCAGGACCGGCTGGCCAAGCTGCAGGAGGCCTACTGCCAGTACCTACTCTCCTACGACTCCCTGTCCCCAGAGGAGCACCGGCGGCTGGAGAAGGAGGTGCTGATGGAGAAGGAGATCCTGGAGAAGCGCAAGGGGCCGCTGGAAGGCCACACAGAGAACGACCACCACAAGTTCCACCCTCTGCCCCGCTTCGAGCCCAAGAATGGGCTCATCCACGGCGTGGCCCCCAGGAACGGCTTCCGCAGCAAGCTCAAGGAGGTGGGCCAGGCCCAGTTGAAGACTGGCCGGCGGCGACTCTTCGCTCAGGAAAAAGAAGTGGTCAAGGAAGAGGAGGAGGACAAAGGCGTCCTCAATGACTTCCACAAGTGCATCTATAAGGGAAGGTCTGTTTCTCTAACAACTTTTTATCGAACAGCGAGGAATATCATGAGCATGTGTTTCAGCAAGGAGCCTGCCCCAGCCGAAATCGAGCAAGAGTACTGGAGGCTAGTGGAAGAGAAGGACTGCCACGTGGCAGTGCACTGCGGCAAGGTGGACACCAACACTCACGGCAGTGGATTCCCAGTAGGAAAATCAGAACCCTTTTCGAGGCATGGATGGAACCTCACCGTCCTCCCCAATAACACAGGGTCCATCCTGCGTCACCTCGGTGCTGTGCCTGGAGTGACTATTCCCTGGCTAAATATTGGCATGGTCTTTTCTACCTCATGCTGGTCTCGAGACCAAAATCACCTTCCATACATTGACTACTTACACACTGGTGCTGACTGCATTTGGTATTGCATTCCTGCTGAGGAGGAGAACAAGCTGGAAGATGTGGTCCACACCCTGCTGCAAGCCAATGGCACCCCAGGGCTGCAGATGCTGGAAAGCAACGTCATGATCTCCCCGGAGGTGCTGTGCAAAGAGGGGATCAAGGTGCACAGGACCGTGCAGCAGAGTGGCCAGTTTGTCGTCTGCTTCCCGGGATCCTTTGTGTCCAAAGTGTGCTGTGGGTACAGCGTGTCTGAAACCGTGCACTTTGCTACCACCCAGTGGACAAGTATGGGCTTTGAGACCGCCAAGGAAATGAAGCGTCGCCATATAGCTAAGCCATTCTCCATGGAGAAGTTACTCTACCAGATTGCACAAGCAGAAGCAAAAAAAGAAAACGGTCCCACTCTCAGTACCATCTCAGCCCTCCTGGATGAGCTCAGGGATACAGAGCTGCGGCAGCGCAGGCAGCTGTTCGAGGCTGGCCTCCACTCCTCCGCACGCTATGGCAGCCACGATGGCAGCAGCACGGTGGCGGACGGGAAGAAAAAGCCTCGAAAGTGGCTGCAGTTGGAGACGTCAGAGAGGAGGTGTCAGATCTGCCAGCACCTGTGCTACCTGTCCATGGTGGTACAAGAGAACGAAAACGTCGTGTTCTGTCTGGAGTGTGCTCTGCGCCACGTGGAGAAACAGAAGTCCTGCCGAGGGCTGAAGTTGATGTACCGCTACGATGAGGAACAGATTATCAGTCTGGTCAATCAGATCTGCGGCAAAGTGTCTGGTAAAAACGGCAGCATTGAGAACTGTCTCAGTAAACCCACACCAAAAAGAGGTCCCCGCAAGAGAGCGACAGTGGACGTGCCCCCCTCCCGTCTGTCAGCCTCCAGTTCATCCAAAAGTGCTTCGAGCTCATCATGA

Length: 3741

View AllClose

0 Reviews

View AllClose