Cusabio Customized Plasmid
Human ING3 cDNA Clone BC009776 pENTR223.1 or pUC Plasmid
(No reviews yet)
Write a Review
- SKU:
- CSB-CL865171HU1
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- ING3
- Gene ID:
- 54556
- Accession #:
- BC009776
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
Description
Human ING3 cDNA Clone BC009776 pENTR223.1 or pUC Plasmid | Cusabio
Gene Name: ING3
Gene ID: 54556
Accession Number: BC009776
Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
Sequence: ATGTTGTACCTAGAAGACTATCTGGAAATGATTGAGCAGCTTCCTATGGATCTGCGGGACCGCTTCACGGAAATGCGCGAGATGGACCTGCAGGTGCAGAATGCAATGGATCAACTAGAACAAAGAGTCAGTGAATTCTTTATGAATGCAAAGAAAAATAAACCTGAGTGGAGGGAAGAGCAAATGGCATCCATCAAAAAAGACTACTATAAAGCTTTGGAAGATGCAGATGAGAAGGTTCAGTTGGCAAACCAGATATATGACTTGCAGCACTTCTAA
Length: 279
Related Products
Human ING3 cDNA Clone BC010851 pENTR223.1 or pUC Plasmid
Cusabio Customized Plasmid
£171.20
Human ING3 cDNA Clone BC010851 pENTR223.1 or pUC Plasmid | CusabioGene Name: ING3Gene ID: 54556Accession Number: BC010851Vector: Vector will be determined during the manufacturing process, either...
- SKU:
- CSB-CL865171HU3
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- ING3
- Gene ID:
- 54556
- Accession #:
- BC010851
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
Human ING3 cDNA Clone BC073865 pUC Plasmid
Cusabio pUC Plasmid
£142.40
Human ING3 cDNA Clone BC073865 pUC Plasmid | CusabioGene Name: ING3Gene ID: 54556Accession Number: BC073865Vector: pUCSequence:...
- SKU:
- CSB-CL865171HU2
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- ING3
- Gene ID:
- 54556
- Accession #:
- BC073865
- Plasmid:
- pUC
Human TMEM206 cDNA Clone BC006320 pENTR223.1 or pUC Plasmid
Cusabio Customized Plasmid
£171.20
Human TMEM206 cDNA Clone BC006320 pENTR223.1 or pUC Plasmid | CusabioGene Name: TMEM206Gene ID: 55248Accession Number: BC006320Vector: Vector will be determined during the manufacturing process,...
- SKU:
- CSB-CL023800HU
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- TMEM206
- Gene ID:
- 55248
- Accession #:
- BC006320
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
Human TLR10 cDNA Clone BC109112 pENTR223.1 or pUC Plasmid
Cusabio Customized Plasmid
£350.40
Human TLR10 cDNA Clone BC109112 pENTR223.1 or pUC Plasmid | CusabioGene Name: TLR10Gene ID: 81793Accession Number: BC109112Vector: Vector will be determined during the manufacturing process, either...
- SKU:
- CSB-CL023600HU
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- TLR10
- Gene ID:
- 81793
- Accession #:
- BC109112
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
Human TMCO3 cDNA Clone BC012564 pENTR223.1 or pUC Plasmid
Cusabio Customized Plasmid
£171.20
Human TMCO3 cDNA Clone BC012564 pENTR223.1 or pUC Plasmid | CusabioGene Name: TMCO3Gene ID: 55002Accession Number: BC012564Vector: Vector will be determined during the manufacturing process, either...
- SKU:
- CSB-CL754406HU1
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- TMCO3
- Gene ID:
- 55002
- Accession #:
- BC012564
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC