Cusabio Customized Plasmid
Human IMMP2L cDNA Clone BC008497 pENTR223.1 or pUC Plasmid
(No reviews yet)
Write a Review
- SKU:
- CSB-CL822306HU
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- IMMP2L
- Gene ID:
- 83943
- Accession #:
- BC008497
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
Description
Human IMMP2L cDNA Clone BC008497 pENTR223.1 or pUC Plasmid | Cusabio
Gene Name: IMMP2L
Gene ID: 83943
Accession Number: BC008497
Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
Sequence: ATGGCACAGTCACAAGGGTGGGTGAAAAGATACATCAAGGCCTTTTGTAAAGGCTTCTTTGTGGCGGTGCCTGTGGCAGTGACTTTCTTGGATCGGGTCGCCTGTGTGGCAAGAGTAGAAGGAGCATCGATGCAGCCTTCTTTGAATCCTGGGGGGAGCCAGTCATCTGATGTGGTGCTTTTGAACCACTGGAAAGTGAGGAATTTTGAAGTACACCGTGGTGACATTGTATCATTGGTGTCTCCTAAAAACCCAGAACAGAAGATCATTAAGAGAGTGATTGCTCTTGAAGGAGATATTGTCAGAGATGGGAGAAAACTGAAAAGGATATGA
Length: 333
Related Products
Human TMEM206 cDNA Clone BC006320 pENTR223.1 or pUC Plasmid
Cusabio Customized Plasmid
€214.00
Human TMEM206 cDNA Clone BC006320 pENTR223.1 or pUC Plasmid | CusabioGene Name: TMEM206Gene ID: 55248Accession Number: BC006320Vector: Vector will be determined during the manufacturing process,...
- SKU:
- CSB-CL023800HU
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- TMEM206
- Gene ID:
- 55248
- Accession #:
- BC006320
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
Human TLR10 cDNA Clone BC109112 pENTR223.1 or pUC Plasmid
Cusabio Customized Plasmid
€438.00
Human TLR10 cDNA Clone BC109112 pENTR223.1 or pUC Plasmid | CusabioGene Name: TLR10Gene ID: 81793Accession Number: BC109112Vector: Vector will be determined during the manufacturing process, either...
- SKU:
- CSB-CL023600HU
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- TLR10
- Gene ID:
- 81793
- Accession #:
- BC109112
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
Human TMCO3 cDNA Clone BC012564 pENTR223.1 or pUC Plasmid
Cusabio Customized Plasmid
€214.00
Human TMCO3 cDNA Clone BC012564 pENTR223.1 or pUC Plasmid | CusabioGene Name: TMCO3Gene ID: 55002Accession Number: BC012564Vector: Vector will be determined during the manufacturing process, either...
- SKU:
- CSB-CL754406HU1
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- TMCO3
- Gene ID:
- 55002
- Accession #:
- BC012564
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
Human TMEM161B cDNA Clone BC037287 pENTR223.1 or pUC Plasmid
Cusabio Customized Plasmid
€214.00
Human TMEM161B cDNA Clone BC037287 pENTR223.1 or pUC Plasmid | CusabioGene Name: TMEM161BGene ID: 153396Accession Number: BC037287Vector: Vector will be determined during the manufacturing process,...
- SKU:
- CSB-CL023736HU
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- TMEM161B
- Gene ID:
- 153396
- Accession #:
- BC037287
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
Human TMEM39A cDNA Clone BC003192 pENTR223.1 or pUC Plasmid
Cusabio Customized Plasmid
€214.00
Human TMEM39A cDNA Clone BC003192 pENTR223.1 or pUC Plasmid | CusabioGene Name: TMEM39AGene ID: 55254Accession Number: BC003192Vector: Vector will be determined during the manufacturing process,...
- SKU:
- CSB-CL023834HU1
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- TMEM39A
- Gene ID:
- 55254
- Accession #:
- BC003192
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC