null

Human IGHD cDNA Clone BC063384 pENTR223.1 or pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL011113HU2
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
IGHD
Gene ID:
3495
Accession #:
BC063384
Plasmid:
Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
€347.00
Frequently bought together:

Description

Human IGHD cDNA Clone BC063384 pENTR223.1 or pUC Plasmid | Cusabio

Gene Name: IGHD

Gene ID: 3495

Accession Number: BC063384

Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC

Sequence: ATGGGCCTCCTGCACAAGAACATGAAACACCTGTGGTTCTTCCTCCTCCTGGTGGCAGCTCCCAGATGGGTCCTGTCTCAGGTGCAGCTGCAGGAGTCGGGCCCAGGACTGGTGAAGCCTTCGGGGACCCTGTCCCTCACCTGCGCTGTCTCTGGTGGCTCCATCAGCAGTAGTAACTGGTGGAGTTGGGTCCGCCAGCCCCCAGGGAAGGGGCTGGAGTGGATTGGGGAAATCTATCATAGTGGGAGCACCAACTACAACCCGTCCCTCAAGAGTCGAGTCACCATATCAGTAGACAAGTCCAAGAACCAGTTCTCCCTGAAGCTGAGCTCTGTGACCGCCGCGGACACGGCCGTGTATTACTGTGCGAGTCTGGGAGACATCTACTACTACGGTATGGACGTCTGGGGCCAAGGGACCACGGTCACCGTCTCCTCAGCACCCACCAAGGCTCCGGATGTGTTCCCCATCATATCAGGGTGCAGACACCCAAAGGATAACAGCCCTGTGGTCCTGGCATGCTTGATAACTGGGTACCACCCAACGTCCGTGACTGTCACCTGGTACATGGGGACACAGAGCCAGCCCCAGAGAACCTTCCCTGAGATACAAAGACGGGACAGCTACTACATGACAAGCAGCCAGCTCTCCACCCCCCTCCAGCAGTGGCGCCAAGGCGAGTACAAATGCGTGGTCCAGCACACCGCCAGCAAGAGTAAGAAGGAGATCTTCCGCTGGCCAGAGTCTCCAAAGGCACAGGCCTCCTCAGTGCCCACTGCACAACCCCAAGCAGAGGGCAGCCTCGCCAAGGCAACCACAGCCCCAGCCACCACCCGTAACACAGGAAGAGGAGGAGAAGAGAAGAAGAAGGAGAAGGAGAAAGAGGAACAAGAAGAGAGAGAGACAAAGACACCAGAGTGTCCGAGCCACACCCAGCCTCTTGGCGTCTACCTGCTAACCCCTGCAGTGCAGGACCTGTGGCTCCGGGACAAAGCCACCTTCACCTGCTTCGTGGTGGGCAGTGACCTGAAGGATGCTCACCTGACCTGGGAGGTGGCTGGGAAGGTCCCCACAGGGGGCGTGGAGGAAGGGCTGCTGGAGCGGCACAGCAACGGCTCCCAGAGCCAGCACAGCCGTCTGACCCTGCCCAGGTCCTTGTGGAACGCGGGGACCTCCATCACCTGCACACTGAACCATCCCAGCCTCCCACCCCAGAGGTTGATGGCGCTGAGAGAACCCGCTGCGCAGGCACCCGTCAAGCTTTCCCTGAACCTGCTGGCCTCGTCTGACCCTCCCGAGGCGGCCTCGTGGCTCCTGTGTGAGGTGTCTGGCTTCTCGCCCCCCAACATCCTCCTGATGTGGCTGGAGGACCAGCGTGAGGTGAACACTTCTGGGTTTGCCCCCGCACGCCCCCCTCCACAGCCCGGGAGCACCACGTTCTGGGCCTGGAGTGTGCTGCGTGTCCCAGCCCCGCCCAGCCCTCAGCCAGCCACCTACACGTGTGTGGTCAGCCACGAGGACTCCCGGACTCTGCTCAACGCCAGCCGGAGCCTAGAAGTCAGCTACCTGGCCATGACCCCCCTGATCCCTCAGAGCAAGGATGAGAACAGCGATGACTACACGACCTTTGATGATGTGGGCAGCCTGTGGACCACCCTGTCCACGTTTGTGGCCCTCTTCATCCTCACCCTCCTCTACAGCGGCATTGTCACTTTCATCAAGGTGAAGTAG

Length: 1731

View AllClose

0 Reviews

View AllClose