null

Human IFIT1 cDNA Clone BC007091 pENTR223.1 or pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL011018HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
IFIT1
Gene ID:
3434
Accession #:
BC007091
Plasmid:
Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
€214.00
Frequently bought together:

Description

Human IFIT1 cDNA Clone BC007091 pENTR223.1 or pUC Plasmid | Cusabio

Gene Name: IFIT1

Gene ID: 3434

Accession Number: BC007091

Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC

Sequence: ATGAGTACAAATGGTGATGATCATCAGGTCAAGGATAGTCTGGAGCAATTGAGATGTCACTTTACATGGGAGTTATCCATTGATGACGATGAAATGCCTGATTTAGAAAACAGAGTCTTGGATCAGATTGAATTCCTAGACACCAAATACAGTGTGGGAATACACAACCTACTAGCCTATGTGAAACACCTGAAAGGCCAGAATGAGGAAGCCCTGAAGAGCTTAAAAGAAGCTGAAAACTTAATGCAGGAAGAACATGACAACCAAGCAAATGTGAGGAGTCTGGTGACCTGGGGCAACTTTGCCTGGATGTATTACCACATGGGCAGACTGGCAGAAGCCCAGACTTACCTGGACAAGGTGGAGAACATTTGCAAGAAGCTTTCAAATCCCTTCCGCTATAGAATGGAGTGTCCAGAAATAGACTGTGAGGAAGGATGGGCCTTGCTGAAGTGTGGAGGAAAGAATTATGAACGGGCCAAGGCCTGCTTTGAAAAGGTGCTTGAAGTGGACCCTGAAAACCCGGAATCCAGCGCTGGGTATGCGATCTCTGCCTATCGCCTGGATGGCTTTAAATTAGCCACAAAAAATCACAAGCCATTTTCTTTGCTTCCCCTAAGGCAGGCTGTCCGCTTAAATCCAGACAATGGATATATTAAGGTTCTCCTTGCCCTGAAGCTTCAGGATGAAGGACAGGAAGCTGAAGGAGAAAAGTACATTGAAGAAGCTCTAGCCAACATGTCCTCACAGACCTATGTCTTTCGATATGCAGCCAAGTTTTACCGAAGAAAAGGCTCTGTGGATAAAGCTCTTGAGTTATTAAAAAAGGCCTTGCAGGAAACACCCACTTCTGTCTTACTGCATCACCAGATAGGGCTTTGCTACAAGGCACAAATGATCCAAATCAAGGAGGCTACAAAAGGGCAGCCTAGAGGGCAGAACAGAGAAAAGCTAGACAAAATGATAAGATCAGCCATATTTCATTTTGAATCTGCAGTGGAAAAAAAGCCCACATTTGAGGTGGCTCATCTAGACCTGGCAAGAATGTATATAGAAGCAGGCAATCACAGAAAAGCTGAAGAGAATTTTCAAAAATTGTTATGCATGAAACCAGTGGTAGAAGAAACAATGCAAGACATACATTTCCACTATGGTCGGTTTCAGGAATTTCAAAAGAAATCTGACGTCAATGCAATTATCCATTATTTAAAAGCTATAAAAATAGAACAGGCATCATTAACAAGGGATAAAAGTATCAATTCTTTGAAGAAATTGGTTTTAAGGAAACTTCGGAGAAAGGCATTAGATCTGGAAAGCTTGAGCCTCCTTGGGTTCGTCTACAAATTGGAAGGAAATATGAATGAAGCCCTGGAGTACTATGAGCGGGCCCTGAGACTGGCTGCTGACTTTGAGAACTCTGTGAGACAAGGTCCTTAG

Length: 1437

View AllClose

0 Reviews

View AllClose