null

Human IDH3G cDNA Clone BC000933 pENTR223.1 or pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL010993HU2
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
IDH3G
Gene ID:
3421
Accession #:
BC000933
Plasmid:
Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
€214.00
Frequently bought together:

Description

Human IDH3G cDNA Clone BC000933 pENTR223.1 or pUC Plasmid | Cusabio

Gene Name: IDH3G

Gene ID: 3421

Accession Number: BC000933

Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC

Sequence: ATGGCGCTGAAGGTAGCGACCGTCGCCGGCAGCGCCGCGAAGGCGGTGCTCGGGCCAGCCCTTCTCTGCCGTCCCTGGGAGGTTCTAGGCGCCCACGAGGTCCCCTCGAGGAACATCTTTTCAGAACAAACAATTCCTCCGTCCGCTAAGTATGGCGGGCGGCACACGGTGACCATGATCCCAGGGGATGGCATCGGGCCAGAGCTCATGCTGCATGTCAAGTCCGTCTTCAGGCACGCATGTGTACCAGTGGACTTTGAAGAGGTGCACGTGAGTTCCAATGCTGATGAAGAGGACATTCGCAATGCCATCATGGCCATCCGCCGGAACCGCGTGGCCCTGAAGGGCAACATCGAAACCAACCATAACCTGCCACCGTCGCACAAATCTCGAAACAACATCCTTCGCACCAGCCTGGACCTCTATGCCAACGTCATCCACTGTAAGAGCCTTCCAGGCGTGGTGACCCGGCACAAGGACATAGACATCCTCATTGTCCGGGAGAACACAGAGGGCGAGTACAGCAGCCTGGAGCATGAGAGTGTGGCGGGAGTGGTGGAGAGCCTGAAGATCATCACCAAGGCCAAGTCCCTGCGCATTGCCGAGTATGCCTTCAAGCTGGCGCAGGAGAGCGGGCGCAAGAAAGTGACGGCCGTGCACAAGGCCAACATCATGAAACTGGGCGATGGGCTTTTCCTCCAGTGCTGCAGGGAGGTGGCAGCCCGCTACCCTCAGATCACCTTCGAGAACATGATTGTGGATAACACCACCATGCAGCTGGTGTCCCGGCCCCAGCAGTTTGATGTCATGGTGATGCCCAATCTCTATGGCAACATCGTCAACAATGTCTGCGCGGGACTGGTCGGGGGCCCAGGCCTTGTGGCTGGGGCCAACTATGGCCATGTGTACGCGGTGTTTGAAACAGCTACGAGGAACACCGGCAAGAGTATCGCCAATAAGAACATCGCCAACCCCACGGCCACCCTGCTGGCCAGCTGCATGATGCTGGACCACCTCAAGCTGCACTCCTATGCCACCTCCATCCGTAAGGCTGTCCTGGCATCCATGGACAATGAGAATATGCACACTCCGGACATCGGGGGCCAGGGCACAACATCTGAAGCCATCCAGGACGTCATCCGCCACATCCGCGTCATCAACGGCCGGGCCGTGGAGGCCTAG

Length: 1182

View AllClose

0 Reviews

View AllClose