null

Human HERPUD1 cDNA Clone BC000086 pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL622984HU2
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
HERPUD1
Gene ID:
9709
Accession #:
BC000086
Plasmid:
pUC
€405.00
Frequently bought together:

Description

Human HERPUD1 cDNA Clone BC000086 pUC Plasmid | Cusabio

Gene Name: HERPUD1

Gene ID: 9709

Accession Number: BC000086

Vector: pUC

Sequence: ATGGAGTCCGAGACCGAACCCGAGCCCGTCACGCTCCTGGTGAAGAGCCCCAACCAGCGCCACCGCGACTTGGAGCTGAGTGGCGACCGCGGCTGGAGTGTGGGCCACCTCAAGGCCCACCTGAGCCGCGTCTACCCCGAGCGTCCGCGTCCAGAGGACCAGAGGTTAATTTATTCTGGGAAGCTGTTGTTGGATCACCAATGTCTCAGGGACTTGCTTCCAAAGCAGGAAAAACGGCATGTTTTGCATCTGGTGTGCAATGTGAAGAGTCCTTCAAAAATGCCAGAAATCAACGCCAAGGTGGCTGAATCCACAGAGGAGCCTGCTGGTTCTAATCGGGGACAGTATCCTGAGGATTCCTCAAGTGATGGTTTAAGGCAAAGGGAAGTTCTTCGGAACCTTTCTTCCCCTGGATGGGAAAACATCTCAAGGCCTGAAGCTGCCCAGCAGGCATTCCAAGGCCTGGGTCCTGGTTTCTCCGGTTACACACCCTATGGGTGGCTTCAGCTTTCCTGGTTCCAGCAGATATATGCACGACAGTACTACATGCAATATTTAGCAGCCACTGCTGCATCAGGGGCTTTTGTTCCACCACCAAGTGCACAAGAGATACCTGTGGTCTCTGCACCTGCTCCAGCCCCTATTCACAACCAGTTTCCAGCTGAAAACCAGCCTGCCAATCAGAATGCTGCTCCTCAAGTGGTTGTTAATCCTGGAGCCAATCAAAATTTGCGGATGAATGCACAAGGTGGCCCTATTGTGGAAGAAGATGATGAAATAAATCGAGATTGGTTGGATTGGACCTATTCAGCAGCTACATTTTCTGTTTTTCTCAGTATCCTCTACTTCTACTCCTCCCTGAGCAGATTCCTCATGGTCATGGGGGCCACCGTTGTTATGTACCTGCATCACGTTGGGTGGTTTCCATTTAGACCGAGGCCGGTTCAGAACTTCCCAAATGATGGTCCTCCTCCTGACGTTGTAAATCAGGACCCCAACAATAACTTACAGGAAGGCACTGATCCTGAAACTGAAGACCCCAACCACCTCCCTCCAGACAGGGATGTACTAGATGGCGAGCAGACCAGCCCCTCCTTTATGAGCACAGCATGGCTTGTCTTCAAGACTTTCTTTGCCTCTCTTCTTCCAGAAGGCCCCCCAGCCATCGCAAACTGA

Length: 1176

View AllClose

0 Reviews

View AllClose