Cusabio Customized Plasmid
Human GSTZ1 cDNA Clone BC001453 pENTR223.1 or pUC Plasmid
(No reviews yet)
Write a Review
- SKU:
- CSB-CL009994HU
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- GSTZ1
- Gene ID:
- 2954
- Accession #:
- BC001453
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
Description
Human GSTZ1 cDNA Clone BC001453 pENTR223.1 or pUC Plasmid | Cusabio
Gene Name: GSTZ1
Gene ID: 2954
Accession Number: BC001453
Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
Sequence: ATGCAGGCGGGGAAGCCCATCCTCTATTCCTATTTCCGAAGCTCCTGCTCATGGAGAGTTCGAATTGCTCTGGCCTTGAAAGGCATCGACTACGAGACGGTGCCCATCAATCTCATAAAGGATGGGGGCCAACAGTTTTCTAAGGACTTCCAGGCACTGAATCCTATGAAGCAGGTGCCAACCCTGAAGATTGATGGAATCACCATTCACCAGTCACTGGCCATCATTGAGTATCTAGAGGAGATGCGTCCCACTCCGCGACTTCTGCCTCAGGACCCAAAGAAGAGGGCCAGCGTGCGTATGATTTCTGACCTCATCGCTGGTGGCATCCAGCCCCTGCAGAACCTGTCTGTCCTGAAGCAAGTGGGAGAGGAGATGCAGCTGACCTGGGCCCAGAACGCCATCACTTGTGGCTTTAACGCCCTGGAGCAGATCCTACAGAGCACAGCGGGCATATACTGTGTAGGAGACGAGGTGACCATGGCTGATCTGTGCTTGGTGCCTCAGGTGGCAAATGCTGAAAGATTCAAGGTGGATCTCACCCCCTACCCTACCATCAGCTCCATCAACAAGAGGCTGCTGGTCTTGGAGGCCTTCCAGGTGTCTCACCCCTGCCGGCAGCCAGATACACCCACTGAGCTGAGGGCCTAG
Length: 651
Related Products
Human EPHX1 cDNA Clone BC003567 pENTR223.1 or pUC Plasmid
Cusabio Customized Plasmid
$256.80
Human EPHX1 cDNA Clone BC003567 pENTR223.1 or pUC Plasmid | CusabioGene Name: EPHX1Gene ID: 2052Accession Number: BC003567Vector: Vector will be determined during the manufacturing process, either...
- SKU:
- CSB-CL007734HU
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- EPHX1
- Gene ID:
- 2052
- Accession #:
- BC003567
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
Human ERO1L cDNA Clone BC008674 pENTR223.1 or pUC Plasmid
Cusabio Customized Plasmid
$256.80
Human ERO1L cDNA Clone BC008674 pENTR223.1 or pUC Plasmid | CusabioGene Name: ERO1LGene ID: 30001Accession Number: BC008674Vector: Vector will be determined during the manufacturing process, either...
- SKU:
- CSB-CL846631HU2
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- ERO1L
- Gene ID:
- 30001
- Accession #:
- BC008674
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
Human ERMN cDNA Clone BC026345 pENTR223.1 or pUC Plasmid
Cusabio Customized Plasmid
$256.80
Human ERMN cDNA Clone BC026345 pENTR223.1 or pUC Plasmid | CusabioGene Name: ERMNGene ID: 57471Accession Number: BC026345Vector: Vector will be determined during the manufacturing process, either...
- SKU:
- CSB-CL840553HU
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- ERMN
- Gene ID:
- 57471
- Accession #:
- BC026345
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
Human ETFA cDNA Clone BC015526 pENTR223.1 or pUC Plasmid
Cusabio Customized Plasmid
$256.80
Human ETFA cDNA Clone BC015526 pENTR223.1 or pUC Plasmid | CusabioGene Name: ETFAGene ID: 2108Accession Number: BC015526Vector: Vector will be determined during the manufacturing process, either...
- SKU:
- CSB-CL007844HU
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- ETFA
- Gene ID:
- 2108
- Accession #:
- BC015526
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
Human ESAM cDNA Clone BC016868 pENTR223.1 or pUC Plasmid
Cusabio Customized Plasmid
$256.80
Human ESAM cDNA Clone BC016868 pENTR223.1 or pUC Plasmid | CusabioGene Name: ESAMGene ID: 90952Accession Number: BC016868Vector: Vector will be determined during the manufacturing process, either...
- SKU:
- CSB-CL850258HU
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- ESAM
- Gene ID:
- 90952
- Accession #:
- BC016868
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
Human ERC1 cDNA Clone BC005065 pENTR223.1 or pUC Plasmid
Cusabio Customized Plasmid
$256.80
Human ERC1 cDNA Clone BC005065 pENTR223.1 or pUC Plasmid | CusabioGene Name: ERC1Gene ID: 23085Accession Number: BC005065Vector: Vector will be determined during the manufacturing process, either...
- SKU:
- CSB-CL007767HU
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- ERC1
- Gene ID:
- 23085
- Accession #:
- BC005065
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
Human EPS8L2 cDNA Clone BC080636 pENTR223.1 or pUC Plasmid
Cusabio Customized Plasmid
$525.60
Human EPS8L2 cDNA Clone BC080636 pENTR223.1 or pUC Plasmid | CusabioGene Name: EPS8L2Gene ID: 64787Accession Number: BC080636Vector: Vector will be determined during the manufacturing process, either...
- SKU:
- CSB-CL887991HU
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- EPS8L2
- Gene ID:
- 64787
- Accession #:
- BC080636
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
Human FA2H cDNA Clone BC010453 pENTR223.1 or pUC Plasmid
Cusabio Customized Plasmid
$256.80
Human FA2H cDNA Clone BC010453 pENTR223.1 or pUC Plasmid | CusabioGene Name: FA2HGene ID: 79152Accession Number: BC010453Vector: Vector will be determined during the manufacturing process, either...
- SKU:
- CSB-CL007937HU3
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- FA2H
- Gene ID:
- 79152
- Accession #:
- BC010453
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
Human FA2H cDNA Clone BC017049 pENTR223.1 or pUC Plasmid
Cusabio Customized Plasmid
$256.80
Human FA2H cDNA Clone BC017049 pENTR223.1 or pUC Plasmid | CusabioGene Name: FA2HGene ID: 79152Accession Number: BC017049Vector: Vector will be determined during the manufacturing process, either...
- SKU:
- CSB-CL007937HU2
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- FA2H
- Gene ID:
- 79152
- Accession #:
- BC017049
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC