Cusabio Customized Plasmid
Human FTL cDNA Clone BC067772 pENTR223.1 or pUC Plasmid
(No reviews yet)
Write a Review
- SKU:
- CSB-CL009049HU5
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- FTL
- Gene ID:
- 2512
- Accession #:
- BC067772
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
Description
Human FTL cDNA Clone BC067772 pENTR223.1 or pUC Plasmid | Cusabio
Gene Name: FTL
Gene ID: 2512
Accession Number: BC067772
Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
Sequence: ATGAGCTCCCAGATTCGTCAGAATTATTCCACCGACGTGGAGGCAGCCGTCAACAGCCTGGTCAATTTGTACCTGCAGGCCTCCTACACCTACCTCTCTCTGGGCTTCTATTTCGACCGCGATGATGTGGCTCTGGAAGGCGTGAGCCACTTCTTCCGCGAATTGGCCGAGGAGAAGCGCGAGGGCTACGAGCGTCTCCTGAAGATGCAAAACCAGCGTGGCGGCCGCGCTCTCTTCCAGGACATCAAGGTAACTAGTGTGTGGGTAATGGACTACATCTCCAAGCAGGCCGTGCGCGCGAGGAGCCTTGATTTGAGGGCGTAG
Length: 324
Related Products
Human FTL cDNA Clone BC021670 pENTR223.1 or pUC Plasmid
Cusabio Customized Plasmid
$256.80
Human FTL cDNA Clone BC021670 pENTR223.1 or pUC Plasmid | CusabioGene Name: FTLGene ID: 2512Accession Number: BC021670Vector: Vector will be determined during the manufacturing process, either...
- SKU:
- CSB-CL009049HU4
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- FTL
- Gene ID:
- 2512
- Accession #:
- BC021670
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
Human FTL cDNA Clone BC013928 pENTR223.1 or pUC Plasmid
Cusabio Customized Plasmid
$256.80
Human FTL cDNA Clone BC013928 pENTR223.1 or pUC Plasmid | CusabioGene Name: FTLGene ID: 2512Accession Number: BC013928Vector: Vector will be determined during the manufacturing process, either...
- SKU:
- CSB-CL009049HU2
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- FTL
- Gene ID:
- 2512
- Accession #:
- BC013928
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
Human FTL cDNA Clone BC008439 pENTR223.1 or pUC Plasmid
Cusabio Customized Plasmid
$256.80
Human FTL cDNA Clone BC008439 pENTR223.1 or pUC Plasmid | CusabioGene Name: FTLGene ID: 2512Accession Number: BC008439Vector: Vector will be determined during the manufacturing process, either...
- SKU:
- CSB-CL009049HU1
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- FTL
- Gene ID:
- 2512
- Accession #:
- BC008439
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
Human FTL cDNA Clone BC002991 pENTR223.1 or pUC Plasmid
Cusabio Customized Plasmid
$256.80
Human FTL cDNA Clone BC002991 pENTR223.1 or pUC Plasmid | CusabioGene Name: FTLGene ID: 2512Accession Number: BC002991Vector: Vector will be determined during the manufacturing process, either...
- SKU:
- CSB-CL009049HU3
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- FTL
- Gene ID:
- 2512
- Accession #:
- BC002991
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
Human FTL cDNA Clone BC016715 pENTR223.1 or pUC Plasmid
Cusabio Customized Plasmid
$256.80
Human FTL cDNA Clone BC016715 pENTR223.1 or pUC Plasmid | CusabioGene Name: FTLGene ID: 2512Accession Number: BC016715Vector: Vector will be determined during the manufacturing process, either...
- SKU:
- CSB-CL009049HU6
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- FTL
- Gene ID:
- 2512
- Accession #:
- BC016715
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC