Cusabio Customized Plasmid
Human FAM74A1 cDNA Clone BC118602 pENTR223.1 or pUC Plasmid
(No reviews yet)
Write a Review
- SKU:
- CSB-CL719318HU
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- FAM74A1
- Gene ID:
- 401507
- Accession #:
- BC118602
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
Description
Human FAM74A1 cDNA Clone BC118602 pENTR223.1 or pUC Plasmid | Cusabio
Gene Name: FAM74A1
Gene ID: 401507
Accession Number: BC118602
Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
Sequence: ATGTGGAGGGAGCTCAGAGGCTGTCCTGGAGGAGACGTGGAGACAGCTCAGAGGCTGTCCCAGAGAAGACGTGGAAAGAGCTCAGAGGCTGTCCCAGAGAAGACGTGGAGAGCTCAGAGGATGTCCCAGAGAAGACGTGGAGAGAGTTCAGAGGCTGTCCCGGAGAAGACGTGGAAAGAGCTCAGAAACTCAGAGACTGTCCCGGAGAAGACATGGAAACAGCTCAGACGCTGTCTGCAAGAAGATGTGGAGAGAGTTCAGAGGCTGTCGTTACTGCTGCACTTGGCTGTTTTTCTTTGGATAATTATTGCAATCAATTTTAGTAATTCAGGTGTTAAATCACAGTCAAGCACCTATTTACCTAGTGGTAAAATCCTTAAGTAA
Length: 384
Related Products
Human ZNF177 cDNA Clone BC012012 pENTR223.1 or pUC Plasmid
Cusabio Customized Plasmid
€214.00
Human ZNF177 cDNA Clone BC012012 pENTR223.1 or pUC Plasmid | CusabioGene Name: ZNF177Gene ID: 7730Accession Number: BC012012Vector: Vector will be determined during the manufacturing process, either...
- SKU:
- CSB-CL026558HU
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- ZNF177
- Gene ID:
- 7730
- Accession #:
- BC012012
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
Human ZNF22 cDNA Clone BC010642 pENTR223.1 or pUC Plasmid
Cusabio Customized Plasmid
€214.00
Human ZNF22 cDNA Clone BC010642 pENTR223.1 or pUC Plasmid | CusabioGene Name: ZNF22Gene ID: 7570Accession Number: BC010642Vector: Vector will be determined during the manufacturing process, either...
- SKU:
- CSB-CL026588HU
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- ZNF22
- Gene ID:
- 7570
- Accession #:
- BC010642
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
Human ZNF281 cDNA Clone BC060820 pENTR223.1 or pUC Plasmid
Cusabio Customized Plasmid
€516.00
Human ZNF281 cDNA Clone BC060820 pENTR223.1 or pUC Plasmid | CusabioGene Name: ZNF281Gene ID: 23528Accession Number: BC060820Vector: Vector will be determined during the manufacturing process, either...
- SKU:
- CSB-CL026637HU
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- ZNF281
- Gene ID:
- 23528
- Accession #:
- BC060820
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
Human ZNF323 cDNA Clone BC065241 pENTR223.1 or pUC Plasmid
Cusabio Customized Plasmid
€214.00
Human ZNF323 cDNA Clone BC065241 pENTR223.1 or pUC Plasmid | CusabioGene Name: ZNF323Gene ID: 64288Accession Number: BC065241Vector: Vector will be determined during the manufacturing process, either...
- SKU:
- CSB-CL026672HU2
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- ZNF323
- Gene ID:
- 64288
- Accession #:
- BC065241
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
Human ZNF334 cDNA Clone BC024177 pENTR223.1 or pUC Plasmid
Cusabio Customized Plasmid
€438.00
Human ZNF334 cDNA Clone BC024177 pENTR223.1 or pUC Plasmid | CusabioGene Name: ZNF334Gene ID: 55713Accession Number: BC024177Vector: Vector will be determined during the manufacturing process, either...
- SKU:
- CSB-CL026682HU
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- ZNF334
- Gene ID:
- 55713
- Accession #:
- BC024177
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
Human ZNF343 cDNA Clone BC011862 pENTR223.1 or pUC Plasmid
Cusabio Customized Plasmid
€214.00
Human ZNF343 cDNA Clone BC011862 pENTR223.1 or pUC Plasmid | CusabioGene Name: ZNF343Gene ID: 79175Accession Number: BC011862Vector: Vector will be determined during the manufacturing process, either...
- SKU:
- CSB-CL026689HU1
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- ZNF343
- Gene ID:
- 79175
- Accession #:
- BC011862
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC