null

Human FAM114A2 cDNA Clone BC011414 pENTR223.1 or pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL878875HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
FAM114A2
Gene ID:
10827
Accession #:
BC011414
Plasmid:
Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
€347.00
Frequently bought together:

Description

Human FAM114A2 cDNA Clone BC011414 pENTR223.1 or pUC Plasmid | Cusabio

Gene Name: FAM114A2

Gene ID: 10827

Accession Number: BC011414

Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC

Sequence: ATGTCAGATAAAGATGATATTGAGACTCCACTGCTAACTGAAGCAGCCCCCATCCTTGAAGATGGAAACTGTGAGCCAGCCAAGAATTCTGAGTCTGTTGACCAAGGTGCCAAACCAGAGAGTAAATCAGAACCTGTAGTTTCCACTCGGAAAAGACCAGAGACCAAACCTTCCAGTGACCTTGAGACTTCAAAAGTTCTCCCTATTCAGGATAATGTTTCCAAAGATGTACCCCAGACCAGATGGGGTTATTGGGGGAGCTGGGGCAAGTCCATACTCTCCTCAGCCTCGGCTACAGTAGCTACAGTAGGACAAGGCATTTCAAATGTCATCGAGAAGGCAGAGACTTCCCTTGGAATCCCTAGTCCCAGTGAAATTTCAACTGAAGTCAAGTATGTAGCAGGAGAGACAAATGCCAAAGAGAATGAAAACTCCTCCCCAGTGGCTGGGGCATTTGGTGTATTCTCTACCATCTCTACTGCTGTTCAGAGCACAGGAAAGAGTGTTATAAGTGGGGGTTTGGATGCCTTAGAATTCATTGGAAAAAAGACAATGGATGTGATAGCAGAAGGGGATCCTGGATTTAAAAGAACCAAGGGTCTGATGAACCGAAATGCTACACTATCTCAGGTTTTACGAGAGGCGAAGGAGAAAGAAGAGATACGGACCTCCAATGAGGTTACCGTGGAAACAGACAAGAAAACTCATTATGGGCTACTCTTTGATGAATTTCAAGGCCTTTCACATCTAGAAGCTCTGGAGATGCTTTCCCAAGAAAGTGAAATAAAGGTGAAATCTATCCTTAATTCTCTGAGTGGAGAAGAATTAGAGACTCTAAAAGTTGAATTAGAGCAACTCAAAGAAACATTTTCTCTAGCAGAATTTTGTGAAGAAGAGGAAGAAGAGAAAAAAGGGGATGAAGATTTTACCAAGGACATAACAGAGCTGTTTTCCCAGCTGCACGTTTCCTCCAAACCAGAGAAACTTGCCAGGGCAAGAAATACCGCCCACGAATGGATCAGGAAGTCTCTGACCAAGCCATTAGCAGAGAATGAAGAAGGAGAAAAACAGTCGGAAGCAGAAAATACTGAGCAAGTCAACAAAAATTCAATAGAGGATATCCATGCGTTTGCAATCCGGAGCCTGGCTGAACTGACTGCCTGCTCAATTGAACTATTCCACAAAACAGCTGCATTGGTTCTGCATGGCAGGAAGCAGGAAGTGACAGCCATAGAAAGGAGCCAAACTCTTTCCCAGATGACAATTGTGTTGTGTAAAGAGTTGTCCTCTCTGTCTAAAGAGTTCACTACCTGCCTAACAACTGCTGGGGTCAAAGAAATGGCAGATGTCCTTAACCCATTAATCACTGCAGTATTTCTAGAGGCATCAAACAGTGCCTCCTACATCCAGGACGCCTTTCAGCTACTCTTACCTGTGCTAGAGATCTCTCTCATTGAGAACAAGATTGAATCACACAGACATGAGCTGCAGGGCCAGAAACCTTTGTTAGAACATTGA

Length: 1518

View AllClose

0 Reviews

View AllClose