null

Human FAM114A1 cDNA Clone BC040452 pENTR223.1 or pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL811612HU1
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
FAM114A1
Gene ID:
92689
Accession #:
BC040452
Plasmid:
Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
€347.00
Frequently bought together:

Description

Human FAM114A1 cDNA Clone BC040452 pENTR223.1 or pUC Plasmid | Cusabio

Gene Name: FAM114A1

Gene ID: 92689

Accession Number: BC040452

Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC

Sequence: ATGTCTGATGATGCTGGTGACACCTTAGCCACTGGAGACAAAGCAGAAGTTACTGAGATGCCTAATAGTGATTCTTTACCTGAGGATGCAGAAGTGCATTGTGATTCAGCTGCAGTTTCACATGAGCCAACACCAGCTGACCCCAGAGGGGAGGGGCATGAAAATGCAGCTGTGCAGGGTGCAGGGGCTGCCGCCATTGGGCCCCCTGTGCAGCCTCAGGATGCCAACGCCCTGGAGCCCCCTCTCAATAGAGACGTGACTGAGGATACACTTGCTGAATGTATTGATTCCGTCAGCCTTGAGGCAGAACCCAGATCCGAAATACCCCTGCAAGAACAGAATTATCCGGCTGTGGATTCCCCTCCAAGTGGAGGAGGATGGGCAGGCTGGGGATCCTGGGGCAAATCTCTGCTGTCGTCAGCATCTGCCACAGTAGGTCATGGATTGACGGCAGTCAAGGAAAAAGCAGGAGCCACTCTACGGATTCATGGTGTAAATTCTGGATCTTCTGAAGGAGCCCAACCAAATACTGAAAACGGAGTCCCTGAAATAACAGATGCAGCCACAGATCAGGGCCCTGCAGAAAGCCCACCCACTTCCCCTTCATCAGCCTCTCGGGGTATGCTGTCTGCCATCACCAATGTGGTTCAAAACACAGGTAAAAGTGTCTTAACTGGAGGCCTTGATGCGTTGGAATTCATCGGCAAGAAAACCATGAATGTCCTTGCAGAAAGTGACCCGGGCTTTAAGCGGACCAAGACGCTCATGGAGAGAACTGTTTCCTTGTCTCAGATGTTAAGGGAAGCTAAGGAGAAGGAGAAGCAGAGACTGGCACAGCAGCTCACGATGGAGAGAACCGCGCACTACGGGATGCTGTTTGATGAATATCAAGGCTTGTCACACCTGGAAGCCCTGGAAATTCTGTCCAATGAAAGCGAAAGCAAGGTTCAGTCATTTTTAGCATCACTTGATGGAGAGAAGCTGGAACTCTTAAAAAATGACCTAATTTCCATTAAAGACATCTTTGCAGCCAAAGAATTAGAGAATGAAGAAAATCAAGAAGAACAAGGCTTAGAAGAAAAGGGAGAAGAATTTGCTCGCATGCTTACAGAGCTTCTCTTTGAATTACATGTGGCGGCCACACCTGACAAACTCAATAAGGCCATGAAGAGGGCTCATGACTGGGTGGAAGAGGATCAAACCGTGGTGTCAGTAGATGTGGCAAAAGTGTCCGAAGAAGAAACAAAGAAGGAAGAAAAGGAAGAGAAATCTCAAGACCCTCAAGAAGACAAAAAGGAGGAAAAGAAAACTAAGACCATAGAGGAAGTATACATGTCGTCCATTGAAAGTCTGGCGGAGGTAACAGCGCGCTGTATTGAGCAGCTTCATAAAGTAGCAGAATTAATTCTTCATGGACAAGAAGAGGAAAAACCAGCTCAGGACCAAGCAAAAGTTCTAATAAAATTAACTACTGCAATGTGCAATGAAGTGGCCTCTTTATCAAAGAAGTTTACGAATTCTTTAACCACTGTTGGGAGCAACAAGAAGGCCGAGGTCCTTAACCCCATGATCAGTAGTGTATTGTTAGAGGGCTGCAACAGTACAACGTACATACAGGATGCCTTCCAGCTGCTGCTGCCTGTTCTGCAGGTCTCACATATCCAGACCAGTTGTTTGAAAGCACAGCCGTGA

Length: 1692

View AllClose

0 Reviews

View AllClose