null

Human FAM108A1 cDNA Clone BC000158 pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL846628HU1
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
FAM108A1
Gene ID:
81926
Accession #:
BC000158
Plasmid:
pUC
€284.00
Frequently bought together:

Description

Human FAM108A1 cDNA Clone BC000158 pUC Plasmid | Cusabio

Gene Name: FAM108A1

Gene ID: 81926

Accession Number: BC000158

Vector: pUC

Sequence: ATGAATGGGCTGTCGCTGAGTGAGCTCTGCTGCCTCTTCTGCTGCCCGCCCTGCCCCGGCCGCATCGCTGCCAAGCTCGCCTTCCTGCCGCCGGAGGCCACCTACTCCCTGGTGCCTGAGCCCGAGCCGGGGCCTGGTGGGGCCGGGGCCGCCCCCTTGGGGACCCTGAGAGCCTCCTCGGGCGCACCCGGGCGCTGGAAGCTGCACCTGACGGAGCGTGCCGACTTCCAGTACAGCCAGCGCGAGCTGGACACCATCGAGGTCTTCCCCACCAAGAGCGCCCGCGGCAACCACGTCTCCTGCATGTATGTTCGCTGCGTGCCTGGTGCCAGGTACACGGTCCTCTTCTCGCACGGCAATGCCGTGGACCTGGGCCAGATGAGCAGCTTCTACATTGGCCTGGGCTCCCGCCTCCACTGCAACATCTTCTCCTACGACTACTCCGGCTACGGTGCCAGCTCGGGCAGGCCTTCCGAGAGGAACCTCTATGCCGACATCGACGCCGCCTGGCAGGCCCTGCGCACCAGGTACGGCATCAGCCCGGACAGCATCATCCTGTACGGGCAGAGCATCGGCACGGTGCCCACCGTGGACCTGGCCTCGCGCTACGAGTGTGCCGCGGTGGTGCTGCACTCGCCGCTCACCTCGGGCATGCGCGTCGCCTTCCCCGACACCAAGAAGACCTACTGCTTCGACGCCTTCCCTAAGTGA

Length: 711

View AllClose

0 Reviews

View AllClose