null

Human FAM106A cDNA Clone BC098363 pENTR223.1 or pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL679880HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
FAM106A
Gene ID:
80039
Accession #:
BC098363
Plasmid:
Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
€214.00
Frequently bought together:

Description

Human FAM106A cDNA Clone BC098363 pENTR223.1 or pUC Plasmid | Cusabio

Gene Name: FAM106A

Gene ID: 80039

Accession Number: BC098363

Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC

Sequence: ATGTTACCGTCTACTATGTTCCTCGTGCACCTTCCACTCAGCACAAACAGGCTGCACTGCCTCCGAAACACATCACTTGAATCCTGCCTCTGCTCCTTTGTCCATCTGAATCACCCTCTCCACATTTCTGACCCTGTAATCCTGATCTCACTTCATGAGGCAGTTCGCTTCTCTTTTGCATTTAGCTTTCCCCGGGGTACACTGTCAATAGCCTACTGTCTGATGTCATCAGTCAGCACTTCATCAGAGGCAATTATGTCCACAGAGCTTTTGGCTAATTACTGTCACTCCTCTTTACATGTGTGCATATGCATATCATCTTTCCCTAATGAGACTGGAAATCATGATTCATTCCCTGGAGCAGTGGTTTCCATAAGTGACCAACCCACAGACCAGTGCAAACTGGCTGCAAAAGAGCTTCCTCTGAGGAACTTATTAGAATGCAGATTCTTTGACTGCATGGGAGAGGAGGATCTCATAAATCTGGGTGTAATAGGCACAGAACGTTAG

Length: 510

View AllClose

0 Reviews

View AllClose