null

Human FAM104A cDNA Clone BC011054 pENTR223.1 or pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL836173HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
FAM104A
Gene ID:
84923
Accession #:
BC011054
Plasmid:
Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
€214.00
Frequently bought together:

Description

Human FAM104A cDNA Clone BC011054 pENTR223.1 or pUC Plasmid | Cusabio

Gene Name: FAM104A

Gene ID: 84923

Accession Number: BC011054

Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC

Sequence: ATGAGCGAGCGCCTCCGTCCCAGGAAAAGGAGAAGGAATGGCAACGAAGAAGACAACCATCTTCCCCCCCAGACCAAAAGAAGTAGCAGAAACCCTGTCTTTCAGGATTCCTGGGACACAGAGTCTTCAGGCAGTGACAGTGGTGGGAGCAGCAGCAGCAGCAGCAGCAGCATCAACAGCCCGGACAGGGCCAGCGGGCCGGAAGGCAGCTTGAGCCAGACCATGGCCGGATCCAGCCCTAACACGCCTCAGCCCGTGCCCGAGCAGTCCGCGCTGTGCCAAGGCCTCTACTTCCACATCAACCAGACCCTGAGGGAGGCCCACTTCCACAGCCTACAGCACCGAGGGCGGCCTCTGACATGA

Length: 363

View AllClose

0 Reviews

View AllClose