null

Human FADD cDNA Clone BC000334 pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL623788HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
FADD
Gene ID:
8772
Accession #:
BC000334
Plasmid:
pUC
€262.00
Frequently bought together:

Description

Human FADD cDNA Clone BC000334 pUC Plasmid | Cusabio

Gene Name: FADD

Gene ID: 8772

Accession Number: BC000334

Vector: pUC

Sequence: ATGGACCCGTTCCTGGTGCTGCTGCACTCGGTGTCGTCCAGCCTGTCGAGCAGCGAGCTGACCGAGCTCAAGTTCCTATGCCTCGGGCGCGTGGGCAAGCGCAAGCTGGAGCGCGTGCAGAGCGGCCTAGACCTCTTCTCCATGCTGCTGGAGCAGAACGACCTGGAGCCCGGGCACACCGAGCTCCTGCGCGAGCTGCTCGCCTCCCTGCGGCGCCACGACCTGCTGCGGCGCGTCGACGACTTCGAGGCGGGGGCGGCGGCCGGGGCCGCGCCTGGGGAAGAAGACCTGTGTGCAGCATTTAACGTCATATGTGATAATGTGGGGAAAGATTGGAGAAGGCTGGCTCGTCAGCTCAAAGTCTCAGACACCAAGATCGACAGCATCGAGGACAGATACCCCCGCAACCTGACAGAGCGTGTGCGGGAGTCACTGAGAATCTGGAAGAACACAGAGAAGGAGAACGCAACAGTGGCCCACCTGGTGGGGGCTCTCAGGTCCTGCCAGATGAACCTGGTGGCTGACCTGGTACAAGAGGTTCAGCAGGCCCGTGACCTCCAGAACAGGAGTGGGGCCATGTCCCCGATGTCATGGAACTCAGACGCATCTACCTCCGAAGCGTCCTGA

Length: 627

View AllClose

0 Reviews

View AllClose