null

Human FABP6 cDNA Clone BC022489 pENTR223.1 or pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL007955HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
FABP6
Gene ID:
2172
Accession #:
BC022489
Plasmid:
Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
€214.00
Frequently bought together:

Description

Human FABP6 cDNA Clone BC022489 pENTR223.1 or pUC Plasmid | Cusabio

Gene Name: FABP6

Gene ID: 2172

Accession Number: BC022489

Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC

Sequence: ATGGCTTTCACCGGCAAGTTCGAGATGGAGAGTGAGAAGAATTATGATGAGTTCATGAAGCTCCTTGGGATCTCCAGCGATGTAATCGAAAAGGCCCACAACTTCAAGATCGTCACGGAGGTGCAGCAGGATGGGCAGGACTTCACTTGGTCCCAGCACTACTACGGGGGCCACACCATGACCAACAAGTTCACTGTTGGCAAGGAAAGCAACATACAGACAATGGGGGGCAAGACGTTCAAGGCCACTGTGCAGATGGAGGGCGGGAAGCTGGTGGTGAATTTCCCCAACTATCACCAGACCTCAGAGATCGTGGGTGACAAGCTGGTGGAGGTCTCCACCATCGGAGGCGTGACCTATGAGCGCGTGAGCAAGAGACTGGCCTAA

Length: 387

View AllClose

0 Reviews

View AllClose