null

Human FABP4 cDNA Clone BC003672 pENTR223.1 Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL007945HU
Availability:
3 to 5 Working Days
Size:
10 μg plasmid + 200μl Glycerol
Gene:
FABP4
Gene ID:
2167
Accession #:
BC003672
Plasmid:
pENTR223.1
€214.00
Frequently bought together:

Description

Human FABP4 cDNA Clone BC003672 pENTR223.1 Plasmid | Cusabio

Gene Name: FABP4

Gene ID: 2167

Accession Number: BC003672

Vector: pENTR223.1

Sequence: ATGTGTGATGCTTTTGTAGGTACCTGGAAACTTGTCTCCAGTGAAAACTTTGATGATTATATGAAAGAAGTAGGAGTGGGCTTTGCCACCAGGAAAGTGGCTGGCATGGCCAAACCTAACATGATCATCAGTGTGAATGGGGATGTGATCACCATTAAATCTGAAAGTACCTTTAAAAATACTGAGATTTCCTTCATACTGGGCCAGGAATTTGACGAAGTCACTGCAGATGACAGGAAAGTCAAGAGCACCATAACCTTAGATGGGGGTGTCCTGGTACATGTGCAGAAATGGGATGGAAAATCAACCACCATAAAGAGAAAACGAGAGGATGATAAACTGGTGGTGGAATGCGTCATGAAAGGCGTCACTTCCACGAGAGTTTATGAGAGAGCATAA

Length: 399

View AllClose

0 Reviews

View AllClose