null

Human F11 cDNA Clone BC119014 pENTR223.1 or pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL007916HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
F11
Gene ID:
2160
Accession #:
BC119014
Plasmid:
Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
€347.00
Frequently bought together:

Description

Human F11 cDNA Clone BC119014 pENTR223.1 or pUC Plasmid | Cusabio

Gene Name: F11

Gene ID: 2160

Accession Number: BC119014

Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC

Sequence: ATGATTTTCTTATATCAAGTGGTACATTTCATTTTATTTACTTCAGTTTCTGGTGAATGTGTGACTCAGTTGTTGAAGGACACCTGCTTTGAAGGAGGGGACATTACTACGGTCTTCACACCAAGCGCCAAGTACTGCCAGGTAGTCTGCACTTACCACCCAAGATGTTTACTCTTCACTTTCACGGCGGAATCACCATCTGAGGATCCCACCCGATGGTTTACTTGTGTCCTGAAAGACAGTGTTACAGAAACACTGCCAAGAGTGAATAGGACAGCAGCGATTTCTGGGTATTCTTTCAAGCAATGCTCACACCAAATAAGCGCTTGCAACAAAGACATTTATGTGGACCTAGACATGAAGGGCATAAACTATAACAGCTCAGTTGCCAAGAGTGCTCAAGAATGCCAAGAAAGATGCACGGATGACGTCCACTGCCACTTTTTCACGTACGCCACAAGGCAGTTTCCCAGCCTGGAGCATCGTAACATTTGTCTACTGAAGCACACCCAAACAGGGACACCAACCAGAATAACGAAGCTCGATAAAGTGGTGTCTGGATTTTCACTGAAATCCTGTGCACTTTCTAATCTGGCTTGTATTAGGGACATTTTCCCTAATACGGTGTTTGCAGACAGCAACATCGACAGTGTCATGGCTCCCGATGCTTTTGTCTGTGGCCGAATCTGCACTCATCATCCCGGTTGCTTGTTTTTTACCTTCTTTTCCCAGGAATGGCCCAAAGAATCTCAAAGAAATCTTTGTCTCCTTAAAACATCTGAGAGTGGATTGCCCAGTACACGCATTAAAAAGAGCAAAGCTCTTTCTGGTTTCAGTCTACAAAGCTGCAGGCACAGCATCCCAGTGTTCTGCCATTCTTCATTTTACCATGACACTGATTTCTTGGGAGAAGAACTGGATATTGTTGCTGCAAAAAGTCACGAGGCCTGCCAGAAACTGTGCACCAATGCCGTCCGCTGCCAGTTTTTTACCTATACCCCAGCCCAAGCATCCTGCAACGAAGGGAAGGGCAAGTGTTACTTAAAGCTTTCTTCAAACGGATCTCCAACTAAAATACTTCACGGGAGAGGAGGCATCTCTGGATACACATTAAGGTTGTGTAAAATGGATAATGAGTGTACCACCAAAATCAAGCCCAGGATCGTTGGAGGAACTGCGTCTGTTCGTGGTGAGTGGCCGTGGCAGGTGACCCTGCACACAACCTCACCCACTCAGAGACACCTGTGTGGAGGCTCCATCATTGGAAACCAGTGGATATTAACAGCCGCTCACTGTTTCTATGGGGTAGAGTCACCTAAGATTTTGCGTGTCTACAGTGGCATTTTAAATCAATCTGAAATAAAAGAGGACACATCTTTCTTTGGGGTTCAAGAAATAATAATCCATGATCAGTATAAAATGGCAGAAAGCGGGTATGATATTGCCTTGTTGAAACTGGAAACCACAGTGAATTACACAGATTCTCAACGACCCATATGCCTGCCTTCCAAAGGAGATAGAAATGTAATATACACTGATTGCTGGGTGACTGGATGGGGGTACAGAAAACTAAGAGACAAAATACAAAATACTCTCCAGAAAGCCAAGATACCCTTAGTGACCAACGAAGAGTGCCAGAAGAGATACAGAGGACATAAAATAACCCATAAGATGATCTGTGCCGGCTACAGGGAAGGAGGGAAGGACGCTTGCAAGGGAGATTCGGGAGGCCCTCTGTCCTGCAAACACAATGAGGTCTGGCATCTGGTAGGCATCACGAGCTGGGGCGAAGGCTGTGCTCAAAGGGAGCGGCCAGGTGTTTACACCAACGTGGTCGAGTACGTGGACTGGATTCTGGAGAAAACTCAAGCAGTGTGA

Length: 1878

View AllClose

0 Reviews

View AllClose