Human EIF1AY cDNA Clone BC005248 pENTR223.1 or pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL007507HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
EIF1AY
Gene ID:
9086
Accession #:
BC005248
Plasmid:
Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
$256.80
Frequently bought together:

Description

Human EIF1AY cDNA Clone BC005248 pENTR223.1 or pUC Plasmid | Cusabio

Gene Name: EIF1AY

Gene ID: 9086

Accession Number: BC005248

Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC

Sequence: ATGCCCAAGAATAAAGGTAAAGGAGGTAAAAACAGGCGCAGGGGTAAAAATGAGAATGAATCTGAAAAAAGAGAGTTGGTGTTTAAAGAGGATGGACAAGAGTATGCTCAGGTAATCAAAATGTTGGGAAATGGACGATTGGAAGCATTGTGTTTTGATGGTGTAAAGAGGTTATGCCATATCAGAGGGAAATTGAGAAAAAAGGTTTGGATAAATACATCAGACATTATATTGGTTGGTCTACGGGACTATCAGGATAACAAAGCTGATGTAATTTTAAAGTACAATGCAGATGAAGCTAGAAGCCTGAAGGCATATGGCGAGCTTCCAGAACATGCTAAAATCAATGAAACAGACACATTTGGTCCTGGAGATGATGATGAAATCCAGTTTGACGATATTGGAGATGATGATGAAGACATTGATGATATCTAA

Length: 435

View AllClose

0 Reviews

View AllClose