Human EIF1AX cDNA Clone BC000793 pENTR223.1 or pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL007506HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
EIF1AX
Gene ID:
1964
Accession #:
BC000793
Plasmid:
Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
€214.00
Frequently bought together:

Description

Human EIF1AX cDNA Clone BC000793 pENTR223.1 or pUC Plasmid | Cusabio

Gene Name: EIF1AX

Gene ID: 1964

Accession Number: BC000793

Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC

Sequence: ATGCCCAAGAATAAAGGTAAAGGAGGTAAAAACAGACGCAGGGGTAAGAATGAGAATGAATCTGAAAAAAGAGAACTGGTATTCAAAGAGGATGGTCAGGAGTATGCTCAGGTAATCAAAATGTTGGGAAATGGACGGCTAGAAGCAATGTGTTTCGATGGTGTAAAGAGGTTATGTCACATCAGAGGAAAATTGAGAAAAAAGGTTTGGATAAATACCTCGGACATTATTTTGGTTGGTCTCCGAGACTACCAGGATAACAAAGCTGATGTAATTTTAAAATACAATGCAGACGAAGCTAGAAGTCTGAAGGCATACGGCGAGCTTCCAGAGCATGCTAAAATCAATGAAACTGATACATTTGGTCCTGGAGATGATGATGAAATTCAGTTTGATGACATTGGAGATGATGATGAAGATATTGATGACATCTAA

Length: 435

View AllClose

0 Reviews

View AllClose