Human EID3 cDNA Clone BC027612 pENTR223.1 or pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL850775HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
EID3
Gene ID:
493861
Accession #:
BC027612
Plasmid:
Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
€214.00
Frequently bought together:

Description

Human EID3 cDNA Clone BC027612 pENTR223.1 or pUC Plasmid | Cusabio

Gene Name: EID3

Gene ID: 493861

Accession Number: BC027612

Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC

Sequence: ATGAAGATGGATGTGTCAGTGAGGGCCGCGGGCTGCTCCGACGACCTCAGCTCTGGGGAGGCCGACGTAGACCCAAAGCTCCTGGAGCTCACCGCTGACGAGGAGAAGTGCCGCAGCATCCGCAGGCAGTACCGGCAGCTCATGTACTGCGTGCGGCAGAACCGGGAGGACATCGTGAGCTCGGCGAACAACTCCTTAACCGAGGCTCTGGAGGAAGCCAACGTCCTCTTTGATGGCGTGAGCCGAACCAGAGAAGCAGCCCTCGACGCCCGGTTTCTTGTTATGGCTTCTGATTTGGGTAAAGAAAAGGCAAAGCAGTTAAACTCAGATATGAACTTCTTTAATCAGTTAGCATTTTGTGACTTTCTGTTTCTGTTCGTGGGTCTGAATTGGATGGAAGGCGATCCTGACAAGTTGAGTGATTGTGATGATAGCATAGCTCTTTCCTTCTGGAAGGCAATAGAAAAGGAAGCAACATCCTGGATGGTAAAAGCTGAGACATTCCATTTTGTTTTTGGTTCATTCAAGCTAGAACGTTCTGCACCAAAGCCCCGACTTGAACACCAGAAAAAAGTTCGCAAGATGGAAGAAAATGGCAACATGCCTACAAAGTTGCAGAAGTTGGACCTGAGTAGTTATCCAGAAGCGACAGAAAAAAACGTAGAAAGGATTTTGGGATTGTTGCAAACCTACTTTCGAAAGTATCCTGATACTCCTGTGTCCTATTTTGAGTTTGTGATTGATCCAAACTCTTTTTCTCGTACTGTGGAGAATATATTTTATGTTTCTTTTATTGTAAGAGATGGTTTTGCAAGAATAAGGCTTGATGAAGACAGGCTGCCAATATTAGAGCCGATGAATGTTAACCAAATGGGTGAGGGAAATGATTCCAGTTGCCATGGCAGGAAACAGGGAGTTATATCTTTGACTTTACAGGAGTGGAAAAACATTGTGGCAGCTTTTGAAATTTCTGAGGCTATGATTACATACTCCTCATACTAA

Length: 1002

View AllClose

0 Reviews

View AllClose