Human EHMT2 cDNA Clone BC002686 pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL846653HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
EHMT2
Gene ID:
10919
Accession #:
BC002686
Plasmid:
pUC
€1,030.00
Frequently bought together:

Description

Human EHMT2 cDNA Clone BC002686 pUC Plasmid | Cusabio

Gene Name: EHMT2

Gene ID: 10919

Accession Number: BC002686

Vector: pUC

Sequence: ATGAGTGATGATGTCCACTCACTGGGAAAGGTGACCTCAGATCTGGCCAAAAGGAGGAAGCTGAACTCAGGAGGTGGCCTGTCGGAGGAGTTAGGTTCTGCCCGGCGTTCAGGAGAAGTGACCCTGACGAAAGGGGACCCCGGGTCCCTGGAGGAGTGGGAGACGGTGGTGGGTGATGACTTCAGTCTCTACTATGATTCCTACTCTGTGGATGAGCGCGTGGACTCCGACAGCAAGTCTGAAGTTGAAGCTCTAACTGAACAACTAAGTGAAGAGGAGGAGGAGGAAGAGGAGGAAGAAGAAGAAGAGGAAGAGGAGGAGGAAGAGGAAGAAGAAGAGGAAGATGAGGAGTCAGGGAATCAGTCAGATAGGAGTGGTTCCAGTGGCCGGCGCAAGGCCAAGAAGAAATGGCGAAAAGACAGCCCATGGGTGAAGCCGTCTCGGAAACGGCGCAAGCGGGAGCCTCCGCGGGCCAAGGAGCCACGAGGAGTGAATGGTGTGGGCTCCTCAGGCCCCAGTGAGTACATGGAGGTCCCTCTGGGGTCCCTGGAGCTGCCCAGCGAGGGGACCCTCTCCCCCAACCACGCTGGGGTGTCCAATGACACATCTTCGCTGGAGACAGAGCGAGGGTTTGAGGAGTTGCCCCTGTGCAGCTGCCGCATGGAGGCACCCAAGATTGACCGCATCAGCGAGAGGGCGGGGCACAAGTGCATGGCCACTGAGAGTGTGGACGGAGAGCTGTCAGGCTGCAATGCCGCCATCCTCAAGCGGGAGACCATGAGGCCATCCAGCCGTGTGGCCCTGATGGTGCTCTGTGAGACCCACCGCGCCCGCATGGTCAAACACCACTGCTGCCCGGGCTGCGGCTACTTCTGCACGGCGGGCACCTTCCTGGAGTGCCACCCTGACTTCCGTGTGGCCCACCGCTTCCACAAGGCCTGTGTGTCTCAGCTGAATGGGATGGTCTTCTGTCCCCACTGTGGGGAGGATGCTTCTGAAGCTCAAGAGGTGACCATCCCCCGGGGTGACGGGGTGACCCCACCGGCCGGCACTGCAGCTCCTGCACCCCCACCCCTGTCCCAGGATGTCCCCGGGAGAGCAGACACTTCTCAGCCCAGTGCCCGGATGCGAGGGCATGGGGAACCCCGGCGCCCGCCCTGCGATCCCCTGGCTGACACCATTGACAGCTCAGGGCCCTCCCTGACCCTGCCCAATGGGGGCTGCCTTTCAGCCGTGGGGCTGCCACTGGGGCCAGGCCGGGAGGCCCTGGAAAAGGCCCTGGTCATCCAGGAGTCAGAGAGGCGGAAGAAGCTCCGTTTCCACCCTCGGCAGTTGTACCTGTCCGTGAAGCAGGGCGAGCTGCAGAAGGTGATCCTGATGCTGTTGGACAACCTGGACCCCAACTTCCAGAGCGACCAGCAGAGCAAGCGCACGCCCCTGCATGCAGCCGCCCAGAAGGGCTCCGTGGAGATCTGCCATGTGCTGCTGCAGGCTGGAGCCAACATAAATGCAGTGGACAAACAGCAGCGGACGCCACTGATGGAGGCCGTGGTGAACAACCACCTGGAGGTAGCCCGTTACATGGTGCAGCGTGGTGGCTGTGTCTATAGCAAGGAGGAGGACGGTTCCACCTGCCTCCACCACGCAGCCAAAATCGGGAACTTGGAGATGGTCAGCCTGCTGCTGAGCACAGGACAGGTGGACGTCAACGCCCAGGACAGTGGGGGGTGGACGCCCATCATCTGGGCTGCAGAGCACAAGCACATCGAGGTGATCCGCATGCTACTGACGCGGGGCGCCGACGTCACCCTCACTGACAACGAGGAGAACATCTGCCTGCACTGGGCCTCCTTCACGGGCAGCGCCGCCATCGCCGAAGTCCTTCTGAATGCGCGCTGTGACCTCCATGCTGTCAACTACCATGGGGACACCCCCCTGCACATCGCAGCTCGGGAGAGCTACCATGACTGCGTGCTGTTATTCCTGTCACGTGGGGCCAACCCTGAGCTGCGGAACAAAGAGGGGGACACAGCATGGGACCTGACTCCCGAGCGCTCCGACGTGTGGTTTGCGCTTCAACTCAACCGCAAGCTCCGACTTGGGGTGGGAAATCGGGCCATCCGCACAGAGAAGATCATCTGCCGGGACGTGGCTCGGGGCTATGAGAACGTGCCCATTCCCTGTGTCAACGGTGTGGATGGGGAGCCCTGCCCTGAGGATTACAAGTACATCTCAGAGAACTGCGAGACGTCCACCATGAACATCGATCGCAACATCACCCACCTGCAGCACTGCACGTGTGTGGACGACTGCTCTAGCTCCAACTGCCTGTGCGGCCAGCTCAGCATCCGGTGCTGGTATGACAAGGATGGGCGATTGCTCCAGGAATTTAACAAGATTGAGCCTCCGCTGATTTTCGAGTGTAACCAGGCGTGCTCATGCTGGAGAAACTGCAAGAACCGGGTCGTACAGAGTGGCATCAAGGTGCGGCTACAGCTCTACCGAACAGCCAAGATGGGCTGGGGGGTCCGCGCCCTGCAGACCATCCCACAGGGGACCTTCATCTGCGAGTATGTCGGGGAGCTGATCTCTGATGCTGAGGCTGATGTGAGAGAGGATGATTCTTACCTCTTCGACTTAGACAACAAGGATGGAGAGGTGTACTGCATAGATGCCCGTTACTATGGCAACATCAGCCGCTTCATCAACCACCTGTGTGACCCCAACATCATTCCCGTCCGGGTCTTCATGCTGCACCAAGACCTGCGATTTCCACGCATCGCCTTCTTCAGTTCCCGAGACATCCGGACTGGGGAGGAGCTAGGGTTTGACTATGGCGACCGCTTCTGGGACATCAAAAGCAAATATTTCACCTGCCAATGTGGCTCTGAGAAGTGCAAGCACTCAGCCGAAGCCATTGCCCTGGAGCAGAGCCGTCTGGCCCGCCTGGACCCACACCCTGAGCTGCTGCCCGAGCTCGGCTCCCTGCCCCCTGTCAACACATGA

Length: 3006

View AllClose

0 Reviews

View AllClose