Human EHD2 cDNA Clone BC014445 pENTR223.1 or pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL873710HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
EHD2
Gene ID:
30846
Accession #:
BC014445
Plasmid:
Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
€347.00
Frequently bought together:

Description

Human EHD2 cDNA Clone BC014445 pENTR223.1 or pUC Plasmid | Cusabio

Gene Name: EHD2

Gene ID: 30846

Accession Number: BC014445

Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC

Sequence: ATGTTCAGCTGGCTGAAGCGGGGCGGGGCACGGGGCCAGCAGCCCGAGGCCATCCGCACGGTGACCTCGGCCCTCAAGGAGCTGTACCGCACGAAGCTGCTGCCGCTGGAGGAGCACTACCGCTTTGGGGCCTTCCACTCGCCGGCCCTGGAGGACGCAGACTTCGACGGCAAGCCCATGGTGCTGGTGGCCGGCCAGTACAGCACGGGCAAGACCAGCTTCATCCAGTACCTGCTGGAGCAGGAGGTGCCCGGCTCCCGCGTGGGGCCTGAGCCCACCACCGACTGCTTTGTGGCCGTCATGCACGGGGACACTGAGGGCACCGTGCCCGGCAACGCCCTCGTCGTGGACCCGGACAAGCCCTTCCGCAAACTCAACCCTTTCGGAAACACCTTCCTCAACAGGTTCATGTGTGCCCAGCTCCCTAATCAGGTCCTGGAGAGCATCAGCATCATCGACACCCCGGGTATCCTGTCGGGTGCCAAGCAGAGAGTGAGCCGCGGCTACGACTTCCCGGCCGTGCTGCGCTGGTTCGCGGAGCGCGTGGACCTCATCATCCTGCTCTTTGATGCGCACAAGCTGGAGATCTCGGACGAGTTCTCAGAGGCCATCGGCGCGTTGCGGGGCCATGAGGACAAGATCCGCGTGGTGCTCAACAAGGCCGACATGGTGGAGACGCAGCAGCTGATGCGCGTCTACGGCGCGCTCATGTGGGCGCTGGGCAAGGTGGTGGGCACGCCCGAGGTGCTGCGCGTCTACATCGGCTCCTTCTGGTCCCAGCCCCTCCTCGTGCCCGACAACCGGCGCCTCTTCGAGCTGGAGGAGCAGGACCTCTTCCGCGACATCCAGGGCCTGCCCCGGCACGCAGCCTTGCGCAAGCTCAACGACCTGGTGAAGAGGGCCCGGCTGGTGCGAGTTCACGCTTACATCATCAGCTACCTGAAGAAGGAGATGCCCTCTGTGTTTGGGAAGGAGAACAAGAAGAAGCAGCTGATCCTCAAACTGCCCGTCATCTTTGCGAAGATTCAGCTGGAACATCACATCTCCCCTGGGGACTTTCCTGATTGCCAGAAAATGCAGGAGCTGCTGATGGCGCATGACTTCACCAAGTTTCACTCGCTGAAGCCGAAGCTGCTGGAGGCACTGGACGAGATGCTGACGCACGACATCGCCAAGCTCATGCCCCTGCTGCGGCAGGAGGAGCTGGAGAGCACCGAGGTGGGCGTGCAGGGGGGCGCTTTTGAGGGCACCCACATGGGCCCGTTTGTGGAGCGGGGACCTGACGAGGCCATGGAGGACGGCGAGGAGGGCTCGGACGACGAGGCCGAGTGGGTGGTGACCAAGGACAAGTCCAAATACGACGAGATCTTCTACAACCTGGCGCCTGCCGACGGCAAGCTGAGCGGCTCCAAGGCCAAGACCTGGATGGTGGGGACCAAGCTCCCCAACTCAGTGCTGGGGCGCATCTGGAAGCTCAGCGATGTGGACCGCGACGGCATGCTGGATGATGAAGAGTTCGCGCTGGCCAGCCACCTCATCGAGGCCAAGCTGGAAGGCCACGGGCTGCCCGCCAACCTGCCCCGTCGCCTGGTGCCACCCTCCAAGCGACGCCACAAGGGCTCCGCCGAGTGA

Length: 1632

View AllClose

0 Reviews

View AllClose