Human EGR2 cDNA Clone BC035625 pENTR223.1 or pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL007485HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
EGR2
Gene ID:
1959
Accession #:
BC035625
Plasmid:
Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
€347.00
Frequently bought together:

Description

Human EGR2 cDNA Clone BC035625 pENTR223.1 or pUC Plasmid | Cusabio

Gene Name: EGR2

Gene ID: 1959

Accession Number: BC035625

Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC

Sequence: ATGATGACCGCCAAGGCCGTAGACAAAATCCCAGTAACTCTCAGTGGTTTTGTGCACCAGCTGTCTGACAACATCTACCCGGTGGAGGACCTCGCCGCCACGTCGGTGACCATCTTTCCCAATGCCGAACTGGGAGGCCCCTTTGACCAGATGAACGGAGTGGCCGGAGATGGCATGATCAACATTGACATGACTGGAGAGAAGAGGTCGTTGGATCTCCCATATCCCAGCAGCTTTGCTCCCGTCTCTGCACCTAGAAACCAGACCTTCACTTACATGGGCAAGTTCTCCATTGACCCTCAGTACCCTGGTGCCAGCTGCTACCCAGAAGGCATAATCAATATTGTGAGTGCAGGCATCTTGCAAGGGGTCACTTCCCCAGCTTCAACCACAGCCTCATCCAGCGTCACCTCTGCCTCCCCCAACCCACTGGCCACAGGACCCCTGGGTGTGTGCACCATGTCCCAGACCCAGCCTGACCTGGACCACCTGTACTCTCCGCCACCGCCTCCTCCTCCTTATTCTGGCTGTGCAGGAGACCTCTACCAGGACCCTTCTGCGTTCCTGTCAGCAGCCACCACCTCCACCTCTTCCTCTCTGGCCTACCCACCACCTCCTTCCTATCCATCCCCCAAGCCAGCCACGGACCCAGGTCTCTTCCCAATGATCCCAGACTATCCTGGATTCTTTCCATCTCAGTGCCAGAGAGACCTACATGGTACAGCTGGCCCAGACCGTAAGCCCTTTCCCTGCCCACTGGACACCCTGCGGGTGCCCCCTCCACTCACTCCACTCTCTACAATCCGTAAGCCCTTTCCCTGCCCACTGGACACCCTGCGGGTGCCCCCTCCACTCACTCCACTCTCTACAATCCGTAACTTTACCCTGGGGGGCCCCAGTGCTGGGGTGACCGGACCAGGGGCCAGTGGAGGCAGCGAGGGACCCCGGCTGCCTGGTAGCAGCTCAGCAGCAGCAGCAGCCGCCGCCGCCGCCGCCTATAACCCACACCACCTGCCACTGCGGCCCATTCTGAGGCCTCGCAAGTACCCCAACAGACCCAGCAAGACGCCGGTGCACGAGAGGCCCTACCCGTGCCCAGCAGAAGGCTGCGACCGGCGGTTCTCCCGCTCTGACGAGCTGACACGGCACATCCGAATCCACACTGGGCATAAGCCCTTCCAGTGTCGGATCTGCATGCGCAACTTCAGCCGCAGTGACCACCTCACCACCCATATCCGCACCCACACCGGTGAGAAGCCCTTCGCCTGTGACTACTGTGGCCGAAAGTTTGCCCGGAGTGATGAGAGGAAGCGCCACACCAAGATCCACCTGAGACAGAAAGAGCGGAAAAGCAGTGCCCCCTCTGCATCGGTGCCAGCCCCCTCTACAGCCTCCTGCTCTGGGGGCGTGCAGCCTGGGGGTACCCTGTGCAGCAGTAACAGCAGCAGTCTTGGCGGAGGGCCGCTCGCCCCTTGCTCCTCTCGGACCCGGACACCTTGA

Length: 1500

View AllClose

0 Reviews

View AllClose