Human EGR1 cDNA Clone BC073983 pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL007484HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
EGR1
Gene ID:
1958
Accession #:
BC073983
Plasmid:
pUC
€523.00
Frequently bought together:

Description

Human EGR1 cDNA Clone BC073983 pUC Plasmid | Cusabio

Gene Name: EGR1

Gene ID: 1958

Accession Number: BC073983

Vector: pUC

Sequence: ATGGCCGCGGCCAAGGCCGAGATGCAGCTGATGTCCCCGCTGCAGATCTCTGACCCGTTCGGATCCTTTCCTCACTCGCCCACCATGGACAACTACCCTAAGCTGGAGGAGATGATGCTGCTGAGCAACGGGGCTCCCCAGTTCCTCGGCGCCGCCGGGGCCCCAGAGGGCAGCGGCAGCAACAGCAGCAGCAGCAGCAGCGGGGGCGGTGGAGGCGGCGGGGGCGGCAGCAACAGCAGCAGCAGCAGCAGCACCTTCAACCCTCAGGCGGACACGGGCGAGCAGCCCTACGAGCACCTGACCGCAGAGTCTTTTCCTGACATCTCTCTGAACAACGAGAAGGTGCTGGTGGAGACCAGTTACCCCAGCCAAACCACTCGACTGCCCCCCATCACCTATACTGGCCGCTTTTCCCTGGAGCCTGCACCCAACAGTGGCAACACCTTGTGGCCCGAGCCCCTCTTCAGCTTGGTCAGTGGCCTAGTGAGCATGACCAACCCACCGGCCTCCTCGTCCTCAGCACCATCTCCAGCGGCCTCCTCCGCCTCCGCCTCCCAGAGCCCACCCCTGAGCTGCGCAGTGCCATCCAACGACAGCAGTCCCATTTACTCAGCGGCACCCACCTTCCCCACGCCGAACACTGACATTTTCCCTGAGCCACAAAGCCAGGCCTTCCCGGGCTCGGCAGGGACAGCGCTCCAGTACCCGCCTCCTGCCTACCCTGCCGCCAAGGGTGGCTTCCAGGTTCCCATGATCCCCGACTACCTGTTTCCACAGCAGCAGGGGGATCTGGGCCTGGGCACCCCAGACCAGAAGCCCTTCCAGGGCCTGGAGAGCCGCACCCAGCAGCCTTCGCTAACCCCTCTGTCTACTATTAAGGCCTTTGCCACTCAGTCGGGCTCCCAGGACCTGAAGGCCCTCAATACCAGCTACCAGTCCCAGCTCATCAAACCCAGCCGCATGCGCAAGTACCCCAACCGGCCCAGCAAGACGCCCCCCCACGAACGCCCTTACGCTTGCCCAGTGGAGTCCTGTGATCGCCGCTTCTCCCGCTCCGACGAGCTCACCCGCCACATCCGCATCCACACAGGCCAGAAGCCCTTCCAGTGCCGCATCTGCATGCGCAACTTCAGCCGCAGCGACCACCTCACCACCCACATCCGCACCCACACAGGCGAAAAGCCCTTCGCCTGCGACATCTGTGGAAGAAAGTTTGCCAGGAGCGATGAACGCAAGAGGCATACCAAGATCCACTTGCGGCAGAAGGACAAGAAAGCAGACAAAAGTGTTGTGGCCTCTTCGGCCACCTCCTCTCTCTCTTCCTACCCGTCCCCGGTTGCTACCTCTTACCCGTCCCCGGTTACTACCTCTTATCCATCCCCGGCCACCACCTCATACCCATCCCCTGTGCCCACCTCCTTCTCCTCTCCCGGCTCCTCGACCTACCCATCCCCTGTGCACAGTGGCTTCCCCTCCCCGTCGGTGGCCACCACGTACTCCTCTGTTCCCCCTGCTTTCCCGGCCCAGGTCAGCAGCTTCCCTTCCTCAGCTGTCACCAACTCCTTCAGCGCCTCCACAGGGCTTTCGGACATGACAGCAACCTTTTCTCCCAGGACAATTGAAATTTGCTAA

Length: 1632

View AllClose

0 Reviews

View AllClose