Human EGLN3 cDNA Clone BC064924 pENTR223.1 or pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL880987HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
EGLN3
Gene ID:
112399
Accession #:
BC064924
Plasmid:
Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
€214.00
Frequently bought together:

Description

Human EGLN3 cDNA Clone BC064924 pENTR223.1 or pUC Plasmid | Cusabio

Gene Name: EGLN3

Gene ID: 112399

Accession Number: BC064924

Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC

Sequence: ATGCCCCTGGGACACATCATGAGGCTGGACCTGGAGAAAATTGCCCTGGAGTACATCGTGCCCTGTCTGCACGAGGTGGGCTTCTGCTACCTGGACAACTTCCTGGGCGAGGTGGTGGGCGACTGCGTCCTGGAGCGCGTCAAGCAGCTGCACTGCACCGGGGCCCTGCGGGACGGCCAGCTGGCGGGGCCGCGCGCCGGCGTCTCCAAGCGACACCTGCGGGGCGACCAGATCACGTGGATCGGGGGCAACGAGGAGGGCTGCGAGGCCATCAGCTTCCTCCTGTCCCTCATCGACAGGCTGGTCCTCTACTGCGGGAGCCGGCTGGGCAAATACTACGTCAAGGAGAGGTCTAAGGCAATGGTGGCTTGCTATCCGGGAAATGGAACAGGTTATGTTCGCCACGTGGACAACCCCAACGGTGATGGTCGCTGCATCACCTGCATCTACTATCTGAACAAGAATTGGGATGCCAAGCTACATGGTGGGATCCTGCGGATATTTCCAGAGGGGAAATCATTCATAGCAGATGTGGAGCCCATTTTTGACAGACTCCTGTTCTTCTGGTCAGATCGTAGGAACCCACACGAAGTGCAGCCCTCTTACGCAACCAGATATGCTATGACTGTCTGGTACTTTGATGCTGAAGAAAGGGCAGAAGCCAAAAAGAAATTCAGGAATTTAACTAGGAAAACTGAATCTGCCCTCACTGAAGACTGA

Length: 720

View AllClose

0 Reviews

View AllClose