Human EGLN1 cDNA Clone BC005369 pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL863932HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
EGLN1
Gene ID:
54583
Accession #:
BC005369
Plasmid:
pUC
€200.00
Frequently bought together:

Description

Human EGLN1 cDNA Clone BC005369 pUC Plasmid | Cusabio

Gene Name: EGLN1

Gene ID: 54583

Accession Number: BC005369

Vector: pUC

Sequence: ATGGTTGCTTGTTATCCGGGCAATGGAACGGGTTATGTACGTCATGTTGATAATCCAAATGGAGATGGAAGATGTGTGACATGTATATATTATCTTAATAAAGACTGGGATGCCAAGGTAAGTGGAGGTATACTTCGAATTTTTCCAGAAGGCAAAGCCCAGTTTGCTGACATTGAACCCAAATTTGATAGACTGCTGTTTTTCTGGTCTGACCGTCGCAACCCTCATGAAGTACAACCAGCATATGCTACAAGGTACGCAATAACTGTTTGGTATTTTGATGCAGATGAGAGAGCACGAGCTAAAGTAAAATATCTAACAGGTGAAAAAGGTGTGAGGGTTGAACTCAATAAACCTTCAGATTCGGTCGGTAAAGACGTCTTCTAG

Length: 387

View AllClose

0 Reviews

View AllClose