Human EGF cDNA Clone BC113461 pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL007473HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
EGF
Gene ID:
1950
Accession #:
BC113461
Plasmid:
pUC
€1,186.00
Frequently bought together:

Description

Human EGF cDNA Clone BC113461 pUC Plasmid | Cusabio

Gene Name: EGF

Gene ID: 1950

Accession Number: BC113461

Vector: pUC

Sequence: ATGCTGCTCACTCTTATCATTCTGTTGCCAGTAGTTTCAAAATTTAGTTTTGTTAGTCTCTCAGCACCGCAGCACTGGAGCTGTCCTGAAGGTACTCTCGCAGGAAATGGGAATTCTACTTGTGTGGGTCCTGCACCCTTCTTAATTTTCTCCCATGGAAATAGTATCTTTAGGATTGACACAGAAGGAACCAATTATGAGCAATTGGTGGTGGATGCTGGTGTCTCAGTGATCATGGATTTTCATTATAATGAGAAAAGAATCTATTGGGTGGATTTAGAAAGACAACTTTTGCAAAGAGTTTTTCTGAATGGGTCAAGGCAAGAGAGAGTATGTAATATAGAGAAAAATGTTTCTGGAATGGCAATAAATTGGATAAATGAAGAAGTTATTTGGTCAAATCAACAGGAAGGAATCATTACAGTAACAGATATGAAAGGAAATAATTCCCACATTCTTTTAAGTGCTTTAAAATATCCTGCAAATGTAGCAGTTGATCCAGTAGAAAGGTTTATATTTTGGTCTTCAGAGGTGGCTGGAAGCCTTTATAGAGCAGATCTCGATGGTGTGGGAGTGAAGGCTCTGTTGGAGACATCAGAGAAAATAACAGCTGTGTCATTGGATGTGCTTGATAAGCGGCTGTTTTGGATTCAGTACAACAGAGAAGGAAGCAATTCTCTTATTTGCTCCTGTGATTATGATGGAGGTTCTGTCCACATTAGTAAACATCCAACACAGCATAATTTGTTTGCAATGTCCCTTTTTGGTGACCGTATCTTCTATTCAACATGGAAAATGAAGACAATTTGGATAGCCAACAAACACACTGGAAAGGACATGGTTAGAATTAACCTCCATTCATCATTTGTACCACTTGGTGAACTGAAAGTAGTGCATCCACTTGCACAACCCAAGGCAGAAGATGACACTTGGGAGCCTGAGCAGAAACTTTGCAAATTGAGGAAAGGAAACTGCAGCAGCACTGTGTGTGGGCAAGACCTCCAGTCACACTTGTGCATGTGTGCAGAGGGATACGCCCTAAGTCGAGACCGGAAGTACTGTGAAGATGTTAATGAATGTGCTTTTTGGAATCATGGCTGTACTCTTGGGTGTAAAAACACCCCTGGATCCTATTACTGCACGTGCCCTGTAGGATTTGTTCTGCTTCCTGATGGGAAACGATGTCATCAACTTGTTTCCTGTCCACGCAATGTGTCTGAATGCAGCCATGACTGTGTTCTGACATCAGAAGGTCCCTTATGTTTCTGTCCTGAAGGCTCAGTGCTTGAGAGAGATGGGAAAACATGTAGCGGTTGTTCCTCACCCGATAATGGTGGATGTAGCCAGCTCTGCGTTCCTCTTAGCCCAGTATCCTGGGAATGTGATTGCTTTCCTGGGTATGACCTACAACTGGATGAAAAAAGCTGTGCAGCTTCAGGACCACAACCATTTTTGCTGTTTGCCAATTCTCAAGATATTCGACACATGCATTTTGATGGAACAGACTATGGAACTCTGCTCAGCCAGCAGATGGGAATGGTTTATGCCCTAGATCATGACCCTGTGGAAAATAAGATATACTTTGCCCATACAGCCCTGAAGTGGATAGAGAGAGCTAATATGGATGGTTCCCAGCGAGAAAGGCTTATTGAGGAAGGAGTAGATGTGCCAGAAGGTCTTGCTGTGGACTGGATTGGCCGTAGATTCTATTGGACAGACAGAGGGAAATCTCTGATTGGAAGGAGTGATTTAAATGGGAAACGTTCCAAAATAATCACTAAGGAGAACATCTCTCAACCACGAGGAATTGCTGTTCATCCAATGGCCAAGAGATTATTCTGGACTGATACAGGGATTAATCCACGAATTGAAAGTTCTTCCCTCCAAGGCCTTGGCCGTCTGGTTATAGCCAGCTCTGATCTAATCTGGCCCAGTGGAATAACGATTGACTTCTTAACTGACAAGTTGTACTGGTGCGATGCCAAGCAGTCTGTGATTGAAATGGCCAATCTGGATGGTTCAAAACGCCGAAGACTTACCCAGAATGATGTAGGTCACCCATTTGCTGTAGCAGTGTTTGAGGATTATGTGTGGTTCTCAGATTGGGCTATGCCATCAGTAATAAGAGTAAACAAGAGGACTGGCAAAGATAGAGTACGTCTCCAAGGCAGCATGCTGAAGCCCTCATCACTGGTTGTGGTTCATCCATTGGCAAAACCAGGAGCAGATCCCTGCTTATATCAAAACGGAGGCTGTGAACATATTTGCAAAAAGAGGCTTGGAACTGCTTGGTGTTCGTGTCGTGAAGGTTTTATGAAAGCCTCAGATGGGAAAACGTGTCTGGCTCTGGATGGTCATCAGCTGTTGGCAGGTGGTGAAGTTGATCTAAAGAACCAAGTAACACCATTGGACATCTTGTCCAAGACTAGAGTGTCAGAAGATAACATTACAGAATCTCAACACATGCTAGTGGCTGAAATCATGGTGTCAGATCAAGATGACTGTGCTCCTGTGGGATGCAGCATGTATGCTCGGTGTATTTCAGAGGGAGAGGATGCCACATGTCAGTGTTTGAAAGGATTTGCTGGGGATGGAAAACTATGTTCTGATATAGATGAATGTGAGATGGGTGTCCCAGTGTGCCCCCCTGCCTCCTCCAAGTGCATCAACACCGAAGGTGGTTATGTCTGCCGGTGCTCAGAAGGCTACCAAGGAGATGGGATTCACTGTCTTGATATTGATGAGTGCCAACTGGGGGTGCACAGCTGTGGAGAGAATGCCAGCTGCACAAATACAGAGGGAGGCTATACCTGCATGTGTGCTGGACGCCTGTCTGAACCAGGACTGATTTGCCCTGACTCTACTCCACCCCCTCACCTCAGGGAAGATGACCACCACTATTCCGTAAGAAATAGTGACTCTGAATGTCCCCTGTCCCACGATGGGTACTGCCTCCATGATGGTGTGTGCATGTATATTGAAGCATTGGACAAGTATGCATGCAACTGTGTTGTTGGCTACATCGGGGAGCGATGTCAGTACCGAGACCTGAAGTGGTGGGAACTGCGCCACGCTGGCCACGGGCAGCAGCAGAAGGTCATCGTGGTGGCTGTCTGCGTGGTGGTGCTTGTCATGCTGCTCCTCCTGAGCCTGTGGGGGGCCCACTACTACAGGACTCAGAAGCTGCTATCGAAAAACCCAAAGAATCCTTATGAGGAGTCGAGCAGAGATGTGAGGAGTCGCAGGCCTGCTGACACTGAGGATGGGATGTCCTCTTGCCCTCAACCTTGGTTTGTGGTTATAAAAGAACACCAAGACCTCAAGAATGGGGGTCAACCAGTGGCTGGTGAGGATGGCCAGGCAGCAGATGGGTCAATGCAACCAACTTCATGGAGGCAGGAGCCCCAGTTATGTGGAATGGGCACAGAGCAAGGCTGCTGGATTCCAGTATCCAGTGATAAGGGCTCCTGTCCCCAGGTAATGGAGCGAAGCTTTCATATGCCCTCCTATGGGACACAGACCCTTGAAGGGGGTGTCGAGAAGCCCCATTCTCTCCTATCAGCTAACCCATTATGGCAACAAAGGGCCCTGGACCCACCACACCAAATGGAGCTGACTCAGTGA

Length: 3624

View AllClose

0 Reviews

View AllClose