Human EFTUD2 cDNA Clone BC002360 pENTR223.1 or pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL617995HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
EFTUD2
Gene ID:
9343
Accession #:
BC002360
Plasmid:
Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
€516.00
Frequently bought together:

Description

Human EFTUD2 cDNA Clone BC002360 pENTR223.1 or pUC Plasmid | Cusabio

Gene Name: EFTUD2

Gene ID: 9343

Accession Number: BC002360

Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC

Sequence: ATGGATACCGACTTATATGATGAGTTTGGGAATTATATTGGACCAGAGCTTGATTCTGATGAAGATGATGATGAATTGGGTAGAGAGACCAAAGATCTTGATGAGATGGATGATGATGACGACGACGATGACGTAGGAGATCATGACGATGACCACCCTGGGATGGAGGTGGTGCTGCATGAGGACAAGAAGTACTACCCAACAGCCGAGGAGGTGTATGGTCCTGAGGTGGAGACCATAGTTCAAGAGGAAGACACTCAGCCTCTCACAGAACCCATTATTAAGCCAGTGAAAACCAAGAAATTCACTCTGATGGAGCAGACATTACCTGTTACGGTGTATGAGATGGATTTCTTGGCGGATCTGATGGATAACTCAGAGCTCATCAGAAATGTGACCCTTTGTGGACATCTCCACCATGGCAAGACATGTTTTGTGGATTGTTTAATTGAACAGACTCACCCGGAAATCAGAAAGCGCTATGACCAAGATCTGTGCTATACTGACATCCTCTTCACAGAGCAAGAGAGAGGTGTAGGCATCAAAAGCACTCCTGTGACAGTGGTCTTGCCAGACACCAAAGGAAAATCTTATCTCTTCAATATCATGGACACTCCAGGACATGTGAATTTCTCTGATGAGGTCACAGCTGGCTTGCGCATCTCAGATGGAGTGGTCCTTTTCATTGATGCTGCTGAGGGGGTGATGCTGAACACAGAGCGGCTGATCAAGCATGCGGTGCAGGAGAGGCTGGCAGTCACTGTGTGCATCAACAAGATTGACCGGCTGATCCTGGAGCTGAAGCTGCCTCCAACTGATGCTTATTACAAGCTGCGCCACATTGTGGATGAGGTCAATGGATTAATAAGCATGTATTCCACTGATGAGAACCTGATCCTTTCCCCACTCCTGGGTAACGTCTGCTTCTCCAGCTCCCAGTACAGCATCTGCTTCACGCTGGTCTCCTTTGCCAAGATCTATGCCGACACCTTTGGTGACATTAATTACCAAGAATTTGCTAAAAGACTCTGGGGTGACATCTACTTCAACCCTAAGACGCGAAAGTTCACCAAAAAGGCCCCAACTAGCAGCTCCCAGAGAAGTTTCGTGGAGTTTATCTTGGAGCCTCTTTATAAGATCCTCGCCCAGGTTGTAGGTGACGTGGACACCAGCCTCCCACGGACCCTAGACGAGCTTGGCATCCACCTGACGAAGGAGGAGCTGAAGCTGAACATCCGCCCCTTGCTCAGGCTGGTCTGCAAAAAGTTCTTTGGCGAGTTCACAGGCTTTGTGGACATGTGTGTGCAGCATATCCCTTCTCCAAAGGTGGGCGCCAAGCCCAAGATTGAGCACACCTACACCGGTGGTGTGGACTCCGACCTCGGCGAGGCTATGAGTGACTGTGACCCTGATGGCCCCCTGATGTGCCACACTACTAAGATGTACAGCACAGATGATGGAGTCCAGTTTCACGCCTTTGGCCGGGTGCTGAGTGGCACCATTCATGCTGGGCAGCCTGTGAAGGTACTGGGGGAGAACTACACCCTGGAGGATGAGGAAGACTCCCAGATATGCACCGTGGGCCGCCTTTGGATCTCTGTGGCCAGGTACCACATCGAGGTGAACCGTGTTCCTGCTGGCAACTGGGTTCTGATTGAAGGTGTTGATCAACCAATTGTGAAGACAGCAACCATAACCGAACCCCGAGGCAATGAGGAGGCTCAGATTTTCCGACCCTTGAAGTTCAATACCACATCTGTTATCAAGATTGCTGTGGAGCCAGTCAACCCCTCAGAGCTGCCCAAGATGCTTGATGGCCTGCGCAAGGTCAACAAGAGCTATCCATCCCTCACCACCAAGGTGGAGGAGTCTGGCGAGCATGTGATCCTGGGCACTGGGGAGCTCTACCTGGACTGTGTGATGCATGATTTGCGGAAGATGTACTCAGAGATAGACATCAAGGTGGCTGACCCAGTTGTCACGTTTTGTGAGACGGTGGTGGAAACATCCTCCCTCAAGTGCTTTGCTGAAACGCCTAATAAGAAGAACAAGATCACCATGATTGCTGAGCCTCTTGAGAAGGGCCTGGCAGAGGACATAGAGAATGAGGTGGTCCAGATTACGTGGAACAGGAAGAAGCTGGGAGAGTTCTTCCAGACCAAGTACGATTGGGATCTGCTGGCTGCCCGTTCCATCTGGGCTTTTGGCCCTGATGCGACTGGCCCCAACATTCTGGTGGATGATACTCTGCCCTCTGAGGTGGACAAGGCTCTTCTTGGTTCAGTGAAGGACAGCATCGTTCAAGGTTTCCAGTGGGGAACCAGGGAGGGCCCCCTCTGTGATGAATTGATTCGGAATGTCAAGTTTAAGATCCTGGATGCGGTGGTTGCCCAGGAGCCCCTGCACCGGGGCGGGGGCCAGATCATCCCCACAGCCAGGAGAGTCGTCTACTCTGCCTTCCTCATGGCTACTCCTCGTCTGATGGAGCCTTACTACTTTGTAGAGGTCCAGGCCCCTGCAGATTGCGTCTCTGCAGTTTATACCGTCCTGGCCAGGCGCAGGGGGCACGTGACTCAGGATGCACCCATCCCAGGCTCCCCTCTGTACACCATCAAAGCTTTTATCCCGGCCATCGACTCTTTTGGCTTTGAGACTGATCTCCGGACTCACACCCAGGGACAAGCCTTTTCTCTGTCTGTCTTCCACCACTGGCAGATTGTGCCTGGTGATCCCCTGGACAAGAGCATTGTCATCCGCCCCTTGGAGCCACAGCCAGCTCCTCACCTGGCCCGGGAATTCATGATCAAAACCCGCCGTAGGAAGGGCCTCAGTGAAGATGTGAGCATCAGCAAATTCTTCGATGATCCTATGTTGCTGGAACTTGCCAAACAGGATGTTGTGCTCAATTACCCCATGTGA

Length: 2919

View AllClose

0 Reviews

View AllClose