Human EFS cDNA Clone BC034246 pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL007470HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
EFS
Gene ID:
10278
Accession #:
BC034246
Plasmid:
pUC
€465.00
Frequently bought together:

Description

Human EFS cDNA Clone BC034246 pUC Plasmid | Cusabio

Gene Name: EFS

Gene ID: 10278

Accession Number: BC034246

Vector: pUC

Sequence: ATGGCCATTGCCACGTCGGTGTATGTGGTGCCGCCCCCAGCTCGGCCCTGTCCAACCTCAGGACCTCCAGCTGGACCTTGCCCACCCTCTCCTGACCTCATCTACAAAATCCCCAGAGCTAGTGGGACCCAGCTGGCTGCTCCCAGAGATGCCTTGGAGGTCTACGATGTGCCCCCCACCGCCCTCCGGGTGCCCTCCAGTGGCCCCTATGACTGCCCTGCCTCCTTTTCCCACCCTCTGACCCGGGTTGCCCCGCAGCCCCCTGGAGAGGATGATGCTCCCTATGATGTGCCTCTGACCCCAAAGCCACCTGCAGAGCTGGAACCAGATCTGGAGTGGGAAGGAGGCCGGGAGCCGGGGCCCCCCATCTATGCTGCCCCCTCCAACCTGAAACGAGCGTCAGCCTTACTCAATTTGTATGAAGCACCCGAGGAACTGCTGGCAGACGGGGAGGGCGGGGGCACTGATGAGGGGATCTACGATGTGCCTCTGCTGGGGCCAGAGGCTCCCCCTTCTCCAGAGCCCCCTGGAGCCTTGGCCTCCCATGACCAGGACACCCTGGCCCAGCTTCTGGCCAGAAGCCCCCCACCCCCACACAGGCCCCGGCTCCCCTCAGCTGAGAGCCTGTCCCGCCGCCCTCTGCCTGCCCTGCCTGTCCCTGAGGCCCCCAGCCCCTCCCCAGTGCCCTCTCCTGCCCCAGGCCGGAAGGGCAGCATCCAGGACCGGCCTCTGCCCCCACCCCCACCCCGCCTGCCTGGTTATGGAGGCCCCAAGGTCGAGGGGGATCCAGAGGGCAGGGAGATGGAGGATGACCCAGCAGGACACCACAATGAGTACGAGGGCATTCCGATGGCCGAGGAGTATGACTATGTCCACCTGAAGGGCATGGACAAAGCTCAGGGATCTAGGCCCCCGGATCAGGCCTGCACAGGGGATCCTGAACTGCCCGAGAGGGGGATGCCGGCGCCGCAGGAGGCCCTGTCCCCAGGGGAGCCACTGGTTGTGTCCACCGGAGATCTGCAGCTCCTGTACTTCTATGCTGGGCAATGCCAGAGCCACTACTCAGCCCTGCAGGCAGCCGTGGCAGCCCTGATGTCCAGTACCCAGGCTAATCAGCCCCCGCGCCTTTTCGTGCCCCACAGCAAGAGGGTGGTGGTGGCTGCTCATCGCCTGGTGTTTGTTGGGGACACCCTGGGCCGGCTGGCAGCCTCTGCCCCTCTGAGAGCACAGGTCAGGGCTGCAGGTACAGCACTGGGCCAGGCATTGCGGGCCACTGTGCTGGCTGTCAAGGGAGCTGCCCTGGGCTACCCATCCAGCCCTGCCATCCAAGAGATGGTGCAGTGTGTAACAGAACTGGCAGGGCAGGCCCTGCAATTCACTACCCTGCTCACTAGCCTGGCTCCATGA

Length: 1407

View AllClose

0 Reviews

View AllClose