Human EFR3B cDNA Clone BC049384 pENTR223.1 or pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL897089HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
EFR3B
Gene ID:
22979
Accession #:
BC049384
Plasmid:
Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
€438.00
Frequently bought together:

Description

Human EFR3B cDNA Clone BC049384 pENTR223.1 or pUC Plasmid | Cusabio

Gene Name: EFR3B

Gene ID: 22979

Accession Number: BC049384

Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC

Sequence: ATGTGCCACTCGAGCCATGATGACTTAGAAATCAAGACCAAAATTCGAATGTCAGGCATCAAAGGCCTGCAAGGGGTGGTGAGGAAGACGGTGAATGATGAACTGCAGGCCAATATCTGGGACCCACAGCACATGGATAAGATCGTTCCATCACTGCTTTTCAATCTACAGCATGTAGAGGAGGCAGAGAGCCGGTCTCCCTCACCCCTCCAAGCACCTGAGAAGGAGAAAGAGAGCCCCGCGGAGCTGGCTGAGAGGTGTCTTCGGGAGCTGCTGGGCCGGGCTGCCTTTGGCAACATCAAAAACGCCATCAAGCCTGTTCTCATCCATCTGGATAACCATTCTCTTTGGGAACCCAAGGTGTTTGCCATCCGTTGCTTTAAAATCATCATGTACTCAATTCAGCCGCAGCACTCACACCTGGTCATCCAGCAGCTCCTGGGCCACCTGGACGCCAACAGCCGCAGCGCTGCGACGGTGCGCGCGGGCATCGTGGAAGTCTTGTCGGAAGCCGCGGTCATCGCTGCCACCGGCTCTGTGGGGCCCACAGTACTGGAGATGTTCAACACGCTGCTGAGGCAGCTGCGGCTCAGCATCGACTACGCGCTGACCGGGAGCTACGACGGGGCGGTCAGCCTCGGCACCAAGATCATCAAGGAGCACGAGGAGCGCATGTTCCAGGAGGCCGTCATCAAGACCGTGGGCTCCTTTGCCAGCACGCTGCCCACCTACCAGCGCTCCGAGGTGATCCTCTTCATCATGAGCAAGGTCCCGCGGCCATCCCTGCACCAGGCGGTGGACACAGGCAGGACGGGGGAGAATAGGAACCGTCTGACCCAGATTATGCTGCTAAAATCCCTCCTGCAGGTATCCACAGGTTTCCAGTGCAACAACATGATGTCAGCCCTGCCTAGCAACTTCCTGGACCGCCTTCTCTCCACCGCCCTCATGGAGGATGCAGAAATTCGACTCTTTGTTCTAGAGATTCTCATCAGTTTCATTGATCGTCATGGCAACCGCCACAAGTTCTCTACCATCAGTACCCTCAGTGACATCTCTGTCCTGAAGCTAAAAGTGGACAAGTGCTCTCGACAGGACACCGTCTTCATGAAGAAGCACTCCCAGCAGCTCTACAGACACATCTACCTGAGCTGCAAGGAGGAAACAAACGTGCAGAAACACTACGAGGCGCTCTATGGCTTGCTGGCCCTCATCAGCATCGAGCTGGCTAACGAGGAGGTGGTGGTGGACCTCATCCGTCTGGTGCTGGCTGTTCAGGACGTGGCCCAAGTCAATGAGGAGAACTTGCCTGTCTACAACCGCTGTGCCCTCTATGCTCTGGGCGCAGCCTACCTGAACCTCATCAGTCAGCTCACAACAGTGCCTGCCTTCTGCCAGCACATCCATGAGGTGATAGAGACCAGGAAGAAAGAGGCTCCATACATGCTCCCCGAGGATGTGTTTGTGGAGAGGCCCAGGCTGTCTCAGAATCTTGATGGGGTGGTCATTGAGCTCCTCTTCCGCCAGAGCAAGATCAGTGAAGTCCTGGGAGGCAGTGGCTACAACTCGGACCGGCTCTGCCTGCCCTACATTCCTCAGCTGACAGATGAGGATCGTTTATCCAAGAGGAGGAGCATTGGAGAGACCATCTCCCTGCAGGTGGAGGTAGAATCGAGGAACAGTCCGGAGAAGGAGGAGCGAGTGCCTGCCGAGGAGATCACCTATGAGACACTGAAGAAAGCCATTGTGGACAGCGTAGCAGTGGAGGAGCAGGAGCGTGAGCGGCGGCGGCAGGTGGTGGAGAAGTTCCAGAAGGCACCCTTCGAGGAGATTGCTGCACACTGCGGGGCCCGGGCATCGCTGCTCCAGAGCAAACTCAATCAGATCTTTGAAATCACCATCCGGCCCCCACCAAGCCCATCAGGAACCATCACTGCAGCCTACGGTCAGCCGCAGAACCACTCCATCCCCGTCTACGAAATGAAGTTTCCCGATCTGTGTGTATACTGA

Length: 2010

View AllClose

0 Reviews

View AllClose