Human EFNA3 cDNA Clone BC110406 pENTR223.1 or pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL007462HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
EFNA3
Gene ID:
1944
Accession #:
BC110406
Plasmid:
Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
€214.00
Frequently bought together:

Description

Human EFNA3 cDNA Clone BC110406 pENTR223.1 or pUC Plasmid | Cusabio

Gene Name: EFNA3

Gene ID: 1944

Accession Number: BC110406

Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC

Sequence: ATGGCGGCGGCTCCGCTGCTGCTGCTGCTGCTGCTCGTGCCCGTGCCGCTGCTGCCGCTGCTGGCCCAAGGGCCCGGAGGGGCGCTGGGAAACCGGCATGCGGTGTACTGGAACAGCTCCAACCAGCACCTGCGGCGAGAGGGCTACACCGTGCAGGTGAACGTGAACGACTATCTGGATATTTACTGCCCGCACTACAACAGCTCGGGGGTGGGCCCCGGGGCGGGACCGGGGCCCGGAGGCGGGGCAGAGCAGTACGTGCTGTACATGGTGAGCCGCAACGGCTACCGCACCTGCAACGCCAGCCAGGGCTTCAAGCGCTGGGAGTGCAACCGGCCGCACGCCCCGCACAGCCCCATCAAGTTCTCGGAGAAGTTCCAGCGCTACAGCGCCTTCTCTCTGGGCTACGAGTTCCACGCCGGCCACGAGTACTACTACATCTCCACGCCCACTCACAACCTGCACTGGAAGTGTCTGAGGATGAAGGTGTTCGTCTGCTGCGCCTCCACATCGCACTCCGGGGAGAAGCCGGTCCCCACTCTCCCCCAGTTCACCATGGGCCCCAATGTGAAGATCAACGTGCTGGAAGACTTTGAGGGAGAGAACCCTCAGGTGCCCAAGCTTGAGAAGAGCATCAGCGGGACCAGCCCCAAACGGGAACACCTGCCCCTGGCCGTGGGCATCGCCTTCTTCCTCATGACGTTCTTGGCCTCCTAG

Length: 717

View AllClose

0 Reviews

View AllClose