Human EFHC1 cDNA Clone BC020210 pENTR223.1 or pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL708490HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
EFHC1
Gene ID:
114327
Accession #:
BC020210
Plasmid:
Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
€347.00
Frequently bought together:

Description

Human EFHC1 cDNA Clone BC020210 pENTR223.1 or pUC Plasmid | Cusabio

Gene Name: EFHC1

Gene ID: 114327

Accession Number: BC020210

Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC

Sequence: ATGGTGTCCAATCCCGTGCATGGCTTGCCCTTTCTTCCGGGCACGTCCTTTAAGGACTCTACGAAAACAGCCTTCCACAGAAGTCAGACGCTGAGCTACAGGAACGGCTATGCAATTGTTCGACGTCCAACAGTTGGGATAGGCGGAGACCGGCTCCAGTTCAACCAGCTGTCCCAGGCTGAGCTGGATGAGTTGGCCAGTAAGGCACCAGTCTTAACTTATGGCCAACCTAAACAAGCCCCACCTGCGGATTTTATTCCTGCGCATGTGGCCTTTGACAAAAAGGTACTGAAATTTGATGCCTATTTCCAAGAAGATGTTCCTATGTCAACTGAGGAACAGTATAGGATCCGTCAGGTGAACATTTACTATTATCTAGAAGATGACAGCATGTCTGTCATAGAGCCTGTTGTAGAAAATTCTGGAATCCTTCAAGGCAAGTTAATAAAACGCCAGCGGCTAGCCAAGAATGACCGGGGTGACCATTACCATTGGAAAGACCTAAATCGAGGAATAAACATCACAATTTATGGCAAAACTTTCCGCGTTGTTGACTGTGACCAATTCACACAGGTATTTTTAGAAAGCCAAGGAATTGAGTTAAATCCACCAGAGAAGATGGCTCTTGATCCTTACACTGAACTCCGAAAACAGCCTCTTCGTAAGTATGTCACCCCATCAGACTTTGATCAACTCAAGCAATTTCTCACCTTTGACAAACAGGTCCTTCGATTCTATGCAATCTGGGATGATACAGACAGCATGTATGGTGAATGTCGGACCTACATCATTCATTACTATCTTATGGATGATACGGTGGAAATTCGAGAGGTCCACGAACGGAATGATGGGATAGATCCTTTCCCACTCCTAATGAACCGCCAGCGTGTGCCCAAAGTTTTGGTGGAAAATGCAAAGAACTTCCCTCAGTGTGTGCTAGAAATCTCTGACCAAGAAGTGTTGGAATGGTATACTGCTAAAGACTTCATTGTTGGGAAGTCACTCACTATCCTTGGGAGAACTTTCTTCATTTATGATTGTGATCCATTTACTCGACGGTATTACAAAGAGAAGTTTGGAATCACTGATTTACCACGTATTGATGTGAGCAAGCGGGAACCACCTCCAGTAAAACAGGAGTTGCCTCCTTATAACGGTTTTGGACTAGTGGAAGATTCTGCTCAGAATTGTTTTGCTCTCATTCCAAAAGCTCCAAAAAAAGACGTTATTAAAATGCTGGTGAATGATAACAAGGTGCTTCGTTATTTGGCTGTACTGGAATCCCCCATCCCAGAAGACAAAGACCGCAGATTTGTCTTCTCTTACTTTCTAGCTACCGACATGATCAGTATCTTTGAGCCTCCTGTTCGCAATTCTGGTATCATTGGGGGCAAGTACCTTGGCAGGACTAAAGTTGTTAAACCATACTCTACAGTGGACAACCCTGTCTACTATGGCCCCAGTGACTTCTTCATTGGTGCTGTGATTGAAGTGTTTGGTCACCGGTTCATCATCCTTGATACAGACGAGTATGTTTTGAAATACATGGAGAGCAACGCTGCCCAGTATTCACCAGAAGCACTCGCGTCAATTCAGAACCATGTCCGAAAGCGAGAAGCGCCTGCTCCAGAAGCAGAAAGCAAGCAAACTGAAAAGGATCCAGGCGTGCAGGAATTGGAAGCATTAATAGACACAATTCAGAAGCAACTGAAAGATCACTCATGCAAAGACAACATTCGTGAGGCATTTCAAATTTATGACAAGGAAGCTTCAGGATATGTGGACAGAGACATGTTCTTTAAAATCTGTGAATCGCTTAACGTCCCAGTGGATGACTCCTTGGTTAAGGAGTTACTCAGGATGTGCTCTCATGGAGAAGGCAAAATTAACTACTATAACTTTGTTCGTGCTTTCTCAAACTGA

Length: 1923

View AllClose

0 Reviews

View AllClose