Human EFHB cDNA Clone BC028198 pENTR223.1 or pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL822723HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
EFHB
Gene ID:
151651
Accession #:
BC028198
Plasmid:
Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
€438.00
Frequently bought together:

Description

Human EFHB cDNA Clone BC028198 pENTR223.1 or pUC Plasmid | Cusabio

Gene Name: EFHB

Gene ID: 151651

Accession Number: BC028198

Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC

Sequence: ATGGAACCAAGACAGGAAATGGAAAAAGAGTCTACCTGTGTTTTAATGAAACCCAACACAGAGATTAAGCTTCCTGTGGAGGTGGACATTGGACTAACCCAAGCCGAGGGGCCAGATGAGACTAAGAATACAGAGCCCCAAATGGGCTTGGTGATAGAACCTCCCCAATGCCAGTTTGCCCAACAACATGAACAGAGAAAGGAGGCTGGAAACATTGAATCAGGAGTGGAACCTCCAGATCGCATCAGACCCATATACTCTGGGAAGTTTTTTGATCGGACCCCTTGCTGGCCAAGTGCAGGAAAAGTTATTCCAGTTGGTTACAGAGTTGCAACCTGCTTGACTGAAAAACTTCCCAGGCTAATTACTCCACCTGAAGCAAAAAAGTATTTCAACTTCAGATATCCACCTGCTGGAGTAGAAAGAGTATTTTACGGAAGAGCAAATGATCCCCAGATTGCACCTTATTTGACACATGGAATTAGATCTAAAATTTCGATACTGGCAAACACATTGATAAACCCACAGCCTATTACCACATTTCAACAGAAAATTAAAGATAAAAAAGAATCTATATATCTTAGCAATCGACGAGCACCATTAGGAAAATCTCACGATCAAGCACCAGGATTACCAAAAGGCATGGACACAATCAATACGACATTTGGGACAGCAGTCATCAAAGAATACTCTGCTAAAGATGTGGTGAATCCACCAAAATCCTATGAAGAAGTATTTAAAGAAGGAAATGAAGGACATGATTTGTATGTTGTTTCTCACAATGATTATTATGCAGGAGAGGCAAAGAACCGAAAGTATAACCCATCAAGTTTCCATAGGTGTAGTGTGTATGGAGTACCAACACCACATTTTAATGATGGACGAGCCATGGCAAAATCTCTATATTGGCTCCATGAACTACAAATGAAAAGAGGAGCTAAGTTTGTATCCAAAAGAGCAGATGATTTCAAAGAAAAGTTTCAACATAAACTTGGAAGAGTTTTAGATCCCATTGCAGAAACAATGAATGTTCCCCCAGACTGCACATTTGGAGCTTGTCTCCGTCCTGAGGAATATGGAGTTGGTGATCTCATCCATAATAGACTTCCGGATGAATATCTTCGAGGCAAGGATAGACAGCGAGCCCTGATTGCAGCAGTTCGGCATCACCTGAAGAAAGTTAATTACCAAAAGTTTGACACTTTGCTGGCAGCCTTCAGGCACTATGACAAGAAGGGAGATGGGATGATAGATAAAGACGAGCTGCAGGAAGCTTGTGACCAGGCCAACTTGAGTTTAGATGACAAGCTCCTGGACCAGCTATTTGACTACTGTGATGTGGATAATGATGGCTTCATTAACTATCTGGAATTCGCAAATTTTCTTAACTGGAAAGACAAAATGCTTCTTAAAGAGTATGAAGAGAGGGTCATTATTAAAGGTAGAAAACCAGATTGTGTAAACCCTACTGAGGCTAATGTTGAAGAACCTGAACAAACTCTCCTCATAAAGCCAGAAGATATTGTCTTAAAAGAAGCAGGAAGCACAGAAAAGACTCTCCGGACACTTCTGAGACCAAGTGATAAAGTTTCCAACTACTATAAGACAACTTCTTCTGAGATCAATGCAATTGTAGGAGCCATTCCTTCTACTTGTTACCCCATTTGTGGTGTTCCAACCATTCGATCTGACATTCCTGCTCCCCGAATTCGTCGCATCAGTGACAGAACTAATTATGGTGAAGAAGGTAGTGCATATTCACTACTATATCCTACCATTTTTGCCCGGAAAGGAGTGTTTGAAAGAGACTTCTTCAAGACCAGATCAAAAGAAGAGATTGCAGAGATATTGTGTAACATTGGTGTCAAACTGTCTGATGAAGAATTTGAAAATGTATGGAATCTTGCATCAAAAAAGCATCACAGAGGAGAAGTTTGTGTTGAGAACATCAGAAATGTTCTAGATGAGCTACGGCATGCAGACCGGATCAAGTGTAAAACACTCATGTGA

Length: 2010

View AllClose

0 Reviews

View AllClose