Human EFHA1 cDNA Clone BC034965 pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL818265HU1
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
EFHA1
Gene ID:
221154
Accession #:
BC034965
Plasmid:
pUC
€439.00
Frequently bought together:

Description

Human EFHA1 cDNA Clone BC034965 pUC Plasmid | Cusabio

Gene Name: EFHA1

Gene ID: 221154

Accession Number: BC034965

Vector: pUC

Sequence: ATGGCGGCGGCTGCGGGTAGCTGCGCGCGAGTGGCGGCCTGGGGCGGAAAACTGCGACGGGGGCTCGCTGTCAGCCGACAGGCTGTGCGGAGTCCCGGCCCCTTGGCAGCGGCAGTGGCCGGCGCGGCCCTGGCAGGAGCAGGAGCGGCCTGGCACCACAGCCGCGTCAGTGTTGCGGCGCGGGATGGCAGTTTTACAGTCTCCGCACAGAAAAATGTTGAACATGGAATAATATATATTGGGAAACCGTCTCTTCGTAAGCAGCGCTTCATGCAGTTTTCTTCACTCGAACATGAAGGAGAATATTATATGACACCACGAGACTTCCTCTTCTCAGTGATGTTTGAGCAAATGGAACGTAAAACTTCAGTCAAGAAGCTGACAAAAAAGGACATCGAGGATACACTGTCAGGGATCCAAACAGCTGGCTGTGGATCAACTTTTTTCAGAGACCTTGGCGATAAAGGGCTAATTTCATATACCGAGTATCTTTTCTTGCTTACAATCCTCACTAAACCCCATTCTGGATTTCATGTTGCTTTTAAAATGCTGGATACAGATGGTAATGAGATGATTGAAAAAAGGGAATTTTTTAAGCTGCAGAAGATCATAAATAAACAAGATGACTTGATGACAGTGAAAACTAATGAAACTGGATATCAGGAAGCAATAGTGAAAGAACCTGAAATTAACACAACTCTTCAGATGCGTTTCTTTGGAAAAAGAGGACAAAGAAAACTTCATTATAAAGAATTTCGAAGATTTATGGAAAATTTACTAACAGAGATTCAAGAAATGGAATTCCTTCAGTTTTCTAAAGGTTTGAGTTTCATGAGAAAAGAAGACTTTGCAGAGTGGCTACTTTTTTTCACTAACACTGAAAATAAAGATATTTATTGGAAAAATGTGAGAGAGAAGTTGTCAGCAGGAGAGAGCATTAGTTTGGATGAATTCAAGTCATTTTGCCATTTTACAACCCACTTGGAAGACTTTGCTATTGCCATGCAGATGTTCAGTTTAGCTCATCGTCCTGTCAGACTAGCGGAGTTTAAGAGAGCTGTGAAAGTAGCAACAGGACAAGAACTCTCAAACAATATTTTGGACACTGTCTTTAAGATCTTTGATTTGGATGGTGATGAATGTCTTAGTCATGAAGAGTTTCTTGGGGTGTTAAAAAACAGAATGCATCGAGGTTTATGGGTACCACAACATCAGAGTATACAAGAATACTGGAAGTGTGTGAAGAAAGAAAGCATTAAAGGAGTAAAAGAAGTCTGGAAACAAGCTGGAAAAGGTCTTTTTTAA

Length: 1305

View AllClose

0 Reviews

View AllClose