Human EFEMP1 cDNA Clone BC014410 pENTR223.1 or pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL007450HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
EFEMP1
Gene ID:
2202
Accession #:
BC014410
Plasmid:
Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
€214.00
Frequently bought together:

Description

Human EFEMP1 cDNA Clone BC014410 pENTR223.1 or pUC Plasmid | Cusabio

Gene Name: EFEMP1

Gene ID: 2202

Accession Number: BC014410

Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC

Sequence: ATGTTGAAAGCCCTTTTCCTAACTATGCTGACTCTGGCGCTGGTCAAGTCACAGGACACCGAAGAAACCATCACGTACACGCAATGCACTGACGGATATGAGTGGGATCCTGTGAGACAGCAATGCAAAGATATTGATGAATGTGACATTGTCCCAGACGCTTGTAAAGGTGGAATGAAGTGTGTCAACCACTATGGAGGATACCTCTGCCTTCCGAAAACAGCCCAGATTATTGTCAATAATGAACAGCCTCAGCAGGAAACACAACCAGCAGAAGGAACCTCAGGGGCAACCACCGGGGTTGTAGCTGCCAGCAGCATGGCAACCAGTGGAGTGTTGCCCGGGGGTGGTTTTGTGGCCAGTGCTGCTGCAGTCGCAGGCCCTGAAATGCAGACTGGCCGAAATAACTTTGTCATCCGGCGGAACCCAGCTGACCCTCAGCGCATTCCCTCCAACCCTTCCCACCGTATCCAGTGTGCAGCAGGCTACGAGCAAAGTGAACACAACGTGTGCCAAGACATAGACGAGTGCACTGCAGGGACGCACAACTGTAGAGCAGACCAAGTGTGCATCAATTTACGGGGATCCTTTGCATGTCAGTGCCCTCCTGGATATCAGAAGCGAGGGGAGCAGTGCGTAGACATAGATGAATGTACCATCCCTCCATATTGCCACCAAAGATGCGTGAATACACCAGGCTCATTTTATTGCCAGTGCAGTCCTGGGTTTCAATTGGCAGCAAACAACTATACCTGCGTAGATATAAATGAATGTGATGCCAGCAATCAATGTGCTCAGCAGTGCTACAACATTCTTGGTTCATTCATCTGTCAGTGCAATCAAGGATATGAGCTAAGCAGTGACAGGCTCAACTGTGAAGACATTGATGAATGCAGAACCTCAAGCTACCTGTGTCAATATCAATGTGTCAATGAACCTGGGAAATTCTCATGTATGTGCCCCCAGGGATACCAAGTGGTGAGAAGTAGAACATGTCAAGATATAAATGAGTGTGAGACCACAAATGAATGCCGGGAGGATGAAATGTGTTGGAATTATCATGGCGGCTTCCGTTGTTATCCACGAAATCCTTGTCAAGATCCCTACATTCTAACACCAGAGAACCGATGTGTTTGCCCAGTCTCAAATGCCATGTGCCGAGAACTGCCCCAGTCAATAGTCTACAAATACATGAGCATCCGATCTGATAGGTCTGTGCCATCAGACATCTTCCAGATACAGGCCACAACTATTTATGCCAACACCATCAATACTTTTCGGATTAAATCTGGAAATGAAAATGGAGAGTTCTACCTACGACAAACAAGTCCTGTAAGTGCAATGCTTGTGCTCGTGAAGTCATTATCAGGACCAAGAGAACATATCGTGGACCTGGAGATGCTGACAGTCAGCAGTATAGGGACCTTCCGCACAAGCTCTGTGTTAAGATTGACAATAATAGTGGGGCCATTTTCATTTTAG

Length: 1482

View AllClose

0 Reviews

View AllClose