Human EFCAB4A cDNA Clone BC033196 pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL818705HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
EFCAB4A
Gene ID:
283229
Accession #:
BC033196
Plasmid:
pUC
€330.00
Frequently bought together:

Description

Human EFCAB4A cDNA Clone BC033196 pUC Plasmid | Cusabio

Gene Name: EFCAB4A

Gene ID: 283229

Accession Number: BC033196

Vector: pUC

Sequence: ATGGCCAGCCCTGGAAAGCCTGGGGCTGATGAGGCCCAGGAGGAGGAGGGGGAACTCGAGGGGGGCTCTGCAGGGCCGCGGGCTGCAATACTGGAGCAGGCTGAGGAGCTGTTTCTGCTGTGTGACAAGGAGGCTAAGGGCTTCATCACCAAGCACGACCTGCAGGGTCTCCAGAGCGACCTGCCCCTCACGCCAGAGCAGCTGGAGGCTGTGTTTGAAAGTCTGGACCAGGCTCACACTGGCTTCCTCACCGCCAGGGAGTTCTGCCTGGGCCTGGGGATGTTTGTGGGGGTGGCGTCAGCCCAGGGAGCGAACCCCTGCAGGACTCCCGAGGAGACCTTTGAGTCGGGCGGGCTCGACGTGCAGGGCACGGCGGGCTCTCTGGATGAGGAGGAGGAAGAGGAGGAGCGATTCCACACTGTGCTGGAGCAGCTGGGGGTGGCCCCGGTCCTGGGCGAGCAGCGGGCTGTGAGGACGCTCTGGGCCAGGCTGCAGCGCGAGCGCCCCGAGCTGCTGGGCTCTTTCGAGGATGTTCTGATACGCGCGTCGGCCTGCCTGGAGGAGGCGGCCCGGGAGCGCGACGGCCTGGAGCAGGCGCTGCGGAGGCGCGAGAGCGAGCACGAGAGGGAGGTGCGCGCTCTGTACGAGGAGACGGAGCAGCTTCGGGAGCAGAGCCGGCGCCCGCCGAGTCAGAACTTCGCCCGCGGGGAGCGGAGAAGCCGTCTGGAGCTGGAGCTGCAGATCCGCGAGCAGGACCTGGAACGCGCGGGCCTGCGGCAGCGGGAGAGACGTGGTCGCCGTCTCCAGGAACATGCAGAAAGAGAAAGTCAGCCTGCTACGGCAACTGGAGCTGCTCAGGGAGCTGAATACACGGCTGCGGGATGA

Length: 885

View AllClose

0 Reviews

View AllClose