Human EEF2K cDNA Clone BC032665 pENTR223.1 or pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL007435HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
EEF2K
Gene ID:
29904
Accession #:
BC032665
Plasmid:
Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
€438.00
Frequently bought together:

Description

Human EEF2K cDNA Clone BC032665 pENTR223.1 or pUC Plasmid | Cusabio

Gene Name: EEF2K

Gene ID: 29904

Accession Number: BC032665

Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC

Sequence: ATGGCAGACGAAGATCTCATCTTCCGCCTGGAAGGCGTTGATGGCGGCCAGTCCCCCCGAGCTGGCCGTGATGGTGATTCTGATGGGGACAGCGACGATGAGGAAGGTTACTTCATCTGCCCCATCACGGATGACCCAAGCTCGAACCAGAATGTCAATTCCAAGGTTAATAAGTACTACAGCAACCTAACAAAAAGTGAGCGGTATAGCTCCAGCGGGTCCCCGGCAAACTCCTTCCACTTCAAGGAAGCCTGGAAGCACGCAATCCAGAAGGCCAAGCACATGCCCGACCCCTGGGCTGAGTTCCACCTGGAAGATATTGCCACCGAACGTGCTACTCGACACAGGTACAACGCCGTCACCGGGGAATGGCTGGATGATGAAGTTCTGATCAAGATGGCATCTCAGCCCTTCGGCCGAGGAGCAATGAGGGAGTGCTTCCGGACGAAGAAGCTCTCCAACTTCTTGCATGCCCAGCAGTGGAAGGGAGCCTCCAACTACGTGGCGAAGCGCTACATCGAGCCCGTAGACCGGGATGTGTACTTTGAGGACGTGCGTCTACAGATGGAGGCCAAGCTCTGGGGGGAGGAGTATAATCGGCACAAGCCCCCCAAGCAGGTGGACATCATGCAGATGTGCATCATCGAGCTGAAGGACAGACCGGGCAAGCCCCTCTTCCACCTGGAGCACTACATCGAGGGCAAGTACATCAAGTACAACTCCAACTCTGGCTTTGTCCGCGATGACAACATCCGCCTGACGCCGCAGGCCTTCAGCCACTTCACTTTTGAGCGTTCCGGCCATCAGCTGATAGTGGTGGACATCCAGGGAGTTGGGGATCTCTACACTGACCCACAGATCCACACGGAGACGGGCACTGACTTTGGAGACGGCAACCTAGGTGTCCGCGGGATGGCGCTCTTCTTCTACTCTCATGCCTGCAACCGGATTTGCGAGAGCATGGGCCTTGCTCCCTTTGACCTCTCGCCCCGGGAGAGGGATGCAGTGAATCAGAACACCAAGCTGCTGCAATCAGCCAAGACCATCTTGAGAGGAACAGAGGAAAAATGTGGGAGCCCCCGAGTAAGGACCCTCTCTGGGAGCCGGCCACCCCTGCTCCGTCCCCTTTCAGAGAACTCTGGAGACGAGAACATGAGCGACGTGACCTTCGACTCTCTCCCTTCTTCCCCATCTTCGGCCACACCACACAGCCAGAAGCTAGACCACCTCCATTGGCCAGTGTTCAGTGACCTCGATAACATGGCATCCAGAGACCATGATCATCTAGACAACCACCGGGAGTCTGAGAATAGTGGGGACAGCGGATACCCCAGTGAGAAGCGGGGTGAGCTGGATGACCCTGAGCCCCGAGAACATGGCCACTCATACAGTAATCGGAAGTACGAGTCTGACGAAGACAGCCTGGGCAGCTCTGGACGGGTATGTGTAGAGAAGTGGAATCTCCTCAACTCCTCCCGCCTCCACCTGCCGAGGGCTTCGGCCGTGGCCCTGGAAGTGCAAAGGCTTAATGCTCTGGACCTCGAAAAGAAAATCGGGAAGTCCATTTTGGGGAAGGTCCATCTGGCCATGGTGCGCTACCACGAGGGTGGGCGCTTCTGCGAGAAGGGCGAGGAGTGGGACCAGGAGTCGGCTGTCTTCCACCTGGAGCACGCAGCCAACCTGGGCGAGCTGGAGGCCATCGTGGGCCTGGGACTCATGTACTCGCAGTTGCCTCATCACATCCTAGCCGATGTCTCTCTGAAGGAGACAGAAGAGAACAAAACCAAAGGATTTGATTACTTACTAAAGGCCGCTGAAGCTGGCGACAGGCAGTCCATGATCCTAGTGGCGCGAGCTTTTGACTCTGGCCAGAACCTCAGCCCGGACAGGTGCCAAGACTGGCTAGAGGCCCTGCACTGGTACAACACTGCCCTGGAGATGACGGACTGTGATGAGGGCGGTGAGTACGACGGAATGCAGGACGAGCCCCGGTACATGATGCTGGCCAGGGAGGCCGAGATGCTGTTCACAGGAGGCTACGGGCTGGAGAAGGACCCGCAGAGATCAGGGGACTTGTATACCCAGGCAGCAGAGGCAGCGATGGAAGCCATGAAGGGCCGACTGGCCAACCAGTACTACCAAAAGGCTGAAGAGGCCTGGGCCCAGATGGAGGAGTAA

Length: 2178

View AllClose

0 Reviews

View AllClose