Human EEF1E1 cDNA Clone BC005291 pENTR223.1 or pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL007432HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
EEF1E1
Gene ID:
9521
Accession #:
BC005291
Plasmid:
Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
€214.00
Frequently bought together:

Description

Human EEF1E1 cDNA Clone BC005291 pENTR223.1 or pUC Plasmid | Cusabio

Gene Name: EEF1E1

Gene ID: 9521

Accession Number: BC005291

Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC

Sequence: ATGGCGGCGGCCGCAGAGTTGTCGCTACTGGAGAAGTCCCTGGGACTGAGTAAGGGGAATAAATACAGTGCTCAGGGCGAGCGACAGATTCCAGTTCTTCAGACAAACAATGGTCCAAGTCTAACAGGATTGACTACTATAGCAGCTCATCTAGTCAAGCAAGCCAACAAAGAATATTTGCTGGGGAGTACTGCAGAAGAAAAAGCAATCGTTCAGCAGTGGTTAGAATACAGGGTCACTCAAGTAGATGGGCACTCCAGTAAAAATGACATCCACACACTGTTGAAGGATCTTAATTCATATCTTGAAGATAAAGTCTACCTTACAGGGTATAACTTTACATTAGCAGATATACTATTGTACTATGGACTTCATCGCTTTATAGTTGACCTGACAGTTCAAGAAAAGGAGAAATATCTTAATGTGTCTCGCTGGTTTTGTCACATTCAGCATTATCCAGGCATCAGGCAACATCTGTCTAGTGTTGTCTTCATCAAGAACAGACTATATACTAATTCCCACTAG

Length: 525

View AllClose

0 Reviews

View AllClose